ID: 1006385898

View in Genome Browser
Species Human (GRCh38)
Location 6:33730754-33730776
Sequence TCGGTGTGGGGTGGAGCTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006385892_1006385898 -9 Left 1006385892 6:33730740-33730762 CCAAGGTCACATGGTCGGTGTGG 0: 1
1: 0
2: 2
3: 12
4: 213
Right 1006385898 6:33730754-33730776 TCGGTGTGGGGTGGAGCTCTGGG No data
1006385887_1006385898 20 Left 1006385887 6:33730711-33730733 CCTAGGCTCGGAGAGATGGGATA 0: 1
1: 0
2: 0
3: 11
4: 145
Right 1006385898 6:33730754-33730776 TCGGTGTGGGGTGGAGCTCTGGG No data
1006385891_1006385898 -8 Left 1006385891 6:33730739-33730761 CCCAAGGTCACATGGTCGGTGTG 0: 1
1: 0
2: 4
3: 34
4: 228
Right 1006385898 6:33730754-33730776 TCGGTGTGGGGTGGAGCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006385898 Original CRISPR TCGGTGTGGGGTGGAGCTCT GGG Intronic