ID: 1006385966

View in Genome Browser
Species Human (GRCh38)
Location 6:33731135-33731157
Sequence CAGGAACTGCACGAGGCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 219}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006385966_1006385975 6 Left 1006385966 6:33731135-33731157 CCAGCAGCCTCGTGCAGTTCCTG 0: 1
1: 0
2: 0
3: 23
4: 219
Right 1006385975 6:33731164-33731186 CCCGAGGCCTCCTAGCTGCCTGG 0: 1
1: 0
2: 1
3: 20
4: 211
1006385966_1006385978 8 Left 1006385966 6:33731135-33731157 CCAGCAGCCTCGTGCAGTTCCTG 0: 1
1: 0
2: 0
3: 23
4: 219
Right 1006385978 6:33731166-33731188 CGAGGCCTCCTAGCTGCCTGGGG 0: 1
1: 0
2: 0
3: 13
4: 152
1006385966_1006385980 15 Left 1006385966 6:33731135-33731157 CCAGCAGCCTCGTGCAGTTCCTG 0: 1
1: 0
2: 0
3: 23
4: 219
Right 1006385980 6:33731173-33731195 TCCTAGCTGCCTGGGGAGCCTGG 0: 1
1: 0
2: 2
3: 35
4: 394
1006385966_1006385982 23 Left 1006385966 6:33731135-33731157 CCAGCAGCCTCGTGCAGTTCCTG 0: 1
1: 0
2: 0
3: 23
4: 219
Right 1006385982 6:33731181-33731203 GCCTGGGGAGCCTGGTGTGCCGG 0: 1
1: 0
2: 1
3: 66
4: 471
1006385966_1006385977 7 Left 1006385966 6:33731135-33731157 CCAGCAGCCTCGTGCAGTTCCTG 0: 1
1: 0
2: 0
3: 23
4: 219
Right 1006385977 6:33731165-33731187 CCGAGGCCTCCTAGCTGCCTGGG 0: 1
1: 0
2: 2
3: 19
4: 157
1006385966_1006385971 -10 Left 1006385966 6:33731135-33731157 CCAGCAGCCTCGTGCAGTTCCTG 0: 1
1: 0
2: 0
3: 23
4: 219
Right 1006385971 6:33731148-33731170 GCAGTTCCTGGGGAACCCCGAGG 0: 1
1: 0
2: 0
3: 11
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006385966 Original CRISPR CAGGAACTGCACGAGGCTGC TGG (reversed) Intronic
900119898 1:1044102-1044124 CCGGAACCGCACTCGGCTGCGGG - Exonic
900207952 1:1439601-1439623 CCGCAACTGCACCACGCTGCAGG + Exonic
900484561 1:2915307-2915329 CAGGAACTGTGCCAGGGTGCCGG + Intergenic
900486207 1:2923986-2924008 CAGCGACTGCCCCAGGCTGCAGG + Intergenic
900680363 1:3913023-3913045 CGGGAGCTGCATGAGGCTGAAGG + Intergenic
901496649 1:9626269-9626291 CAACACCTGCATGAGGCTGCGGG + Intergenic
901668309 1:10838808-10838830 CAGGAAGTGCACCAGCCTCCAGG + Intergenic
902260898 1:15224055-15224077 CAGGTACTGCTCTAGGCTCCAGG + Intergenic
902264981 1:15256826-15256848 CAGAAACTGCAGGGGGATGCAGG + Intronic
903221654 1:21872849-21872871 CAGGGGCTGCCCGGGGCTGCTGG - Intronic
904496864 1:30892038-30892060 CAGGACCTGCAGGAGGCTGGAGG - Intronic
905137461 1:35810457-35810479 CAGAAACTGAACTAGGTTGCAGG - Intronic
905516918 1:38568844-38568866 CTGGAACTGGCAGAGGCTGCTGG - Intergenic
907497283 1:54853459-54853481 CAGGTCCTGCATGAGGCAGCTGG - Exonic
910180678 1:84479348-84479370 GAAGAACTTCAGGAGGCTGCAGG + Exonic
911040809 1:93589252-93589274 CTGGTACTGCACGCGGCTGTAGG + Exonic
912276223 1:108261716-108261738 CAGGAACTGCACAGGGCAGGGGG + Intergenic
912292005 1:108432642-108432664 CAGGAACTGCACAGGGCAGGGGG - Intronic
912651501 1:111443553-111443575 CAGAAAGGGCAGGAGGCTGCTGG - Intronic
912889890 1:113518902-113518924 CAGGTAATGCAAGAGGCAGCTGG + Intronic
912922401 1:113882036-113882058 CAAAAAGTGCAGGAGGCTGCAGG + Intronic
913189604 1:116402512-116402534 CAGGAAGTGAATGAGGCTGATGG - Intronic
914414951 1:147471113-147471135 CATGAACTGCAGGAAGCTGGGGG + Intergenic
915826978 1:159088350-159088372 CAGGAGCTGCATGAGTCAGCTGG + Intronic
916458126 1:164992043-164992065 CAGGAACTCCACATGGCAGCTGG + Intergenic
919059223 1:192609294-192609316 GAGGAACTGCAGAATGCTGCCGG - Intergenic
921564405 1:216699009-216699031 CTGGAACCTCACGAGGCTGAGGG + Intronic
1062938882 10:1407270-1407292 CAGGAGCTGCAGGTGACTGCAGG - Intronic
1063306267 10:4903649-4903671 CATGCACTGCAGAAGGCTGCAGG - Intergenic
1063379237 10:5574115-5574137 CAGGCACTGCAGGAAGTTGCTGG - Intergenic
1063453254 10:6165154-6165176 CATGCACTGCAGAAGGCTGCAGG - Intronic
1063472571 10:6299936-6299958 CAGGCACTGCACTAGGCTCTGGG - Intergenic
1064524069 10:16234832-16234854 CCGTAATTGCACTAGGCTGCTGG - Intergenic
1068169048 10:53370298-53370320 CGGGAAGTGCAAGAGGCTGGGGG + Intergenic
1068489618 10:57706743-57706765 CAGCTAGTCCACGAGGCTGCTGG - Intergenic
1075668268 10:124245831-124245853 CAGGGACTGCAGGAGGATGCTGG + Intergenic
1076704801 10:132295338-132295360 CGGGCACTGCACGATGCTGCAGG - Intronic
1077296866 11:1830451-1830473 CAGGGTCTCCATGAGGCTGCTGG + Intronic
1077923386 11:6657133-6657155 AAGGAGCAGCAGGAGGCTGCAGG + Intergenic
1078081525 11:8207679-8207701 CAGGACCTGCACCTGGCCGCCGG + Intergenic
1078724188 11:13913982-13914004 CAGGAACTGTACTAGGCTCTGGG + Intergenic
1079244794 11:18744154-18744176 GAGGCACTGGACGAGGCTGAAGG - Exonic
1080395272 11:31884282-31884304 CAGTATCTGCACGTGGCTGGTGG - Intronic
1081761156 11:45577181-45577203 CAGGCACTGCACCAGGCACCAGG - Intergenic
1083364152 11:62131226-62131248 CAGGACCTGCCCCAGGCTGCAGG - Intronic
1084342486 11:68515300-68515322 CAGGAACTGGACCAGCCTGTCGG + Intronic
1084356778 11:68644158-68644180 CAGGAACTGGACCAGCCTGTCGG + Intergenic
1087697900 11:101401922-101401944 CGGGAACTTCTCGAGGCTGCAGG + Intergenic
1090333437 11:125947970-125947992 CAGGTTCTGCACGTGGCTGGCGG + Intergenic
1090728901 11:129552779-129552801 CAGGAACTTCAAGAGCCAGCAGG + Intergenic
1091634222 12:2185276-2185298 CAGGAAGTGCTCCAGGCTGGAGG - Intronic
1091708643 12:2719686-2719708 CAGAAACTTCACGGAGCTGCTGG - Intergenic
1091989016 12:4939465-4939487 CAGGATATGCACGAGACAGCTGG - Intergenic
1092555528 12:9557139-9557161 CGGGAACTGCACGGGAGTGCAGG - Intergenic
1092708271 12:11308322-11308344 CAGGAGGTGCCTGAGGCTGCTGG + Exonic
1092712412 12:11353172-11353194 CAGGAGGTGCCTGAGGCTGCTGG + Exonic
1092716148 12:11392892-11392914 CAGGAGGTGCCTGAGGCTGCTGG + Exonic
1093351259 12:18105544-18105566 CAGGAGCTGAACCAGGCTGCGGG - Intronic
1094230108 12:28093051-28093073 CAGGAACTGGAAGAGGCTTTGGG + Intergenic
1097174842 12:57136523-57136545 CAGGCACTGCACTAGGCATCAGG - Intronic
1098070393 12:66668469-66668491 CAGAAACAGCACCAGGCAGCTGG - Intronic
1099644109 12:85328366-85328388 CAGGCACTGCAAGATGCTCCAGG + Intergenic
1101850045 12:108394433-108394455 CTGGAGCTGCTCGAGGCAGCTGG - Intergenic
1101878254 12:108609523-108609545 CAGGCACTCCACAAGGCTACGGG + Intergenic
1102181823 12:110918423-110918445 GGGGAAAGGCACGAGGCTGCTGG + Intronic
1102708467 12:114903625-114903647 CAGGAAGTTCAGGAGACTGCGGG + Intergenic
1103446992 12:121001071-121001093 CTGGTACAGCACCAGGCTGCTGG - Exonic
1103721840 12:122979423-122979445 CAAGAAGTGCAGTAGGCTGCGGG - Exonic
1104381988 12:128315278-128315300 GAGGAACGGGATGAGGCTGCAGG + Intronic
1104689589 12:130815348-130815370 CAGGAACTACAGGAGGATGGAGG - Intronic
1104894477 12:132155062-132155084 CAGGAAATGAACGCGGCTGCCGG + Intergenic
1105053666 12:133078377-133078399 CAGAGACTGCTCGAGGCTGGGGG + Intergenic
1108689019 13:52846144-52846166 CGGGAGCTGCACGCTGCTGCTGG - Exonic
1113865306 13:113518256-113518278 GAGGGACTTCACGGGGCTGCAGG - Intronic
1114723661 14:24910403-24910425 CAGTCACTGCAGCAGGCTGCAGG - Intronic
1117771024 14:59134773-59134795 TAGGAAGGGCAGGAGGCTGCTGG + Intergenic
1121439446 14:93939657-93939679 CAGCATCTGCACGATCCTGCCGG + Exonic
1121906515 14:97751007-97751029 CAGGAACTGGAGAAGGCTGAGGG + Exonic
1122632421 14:103113045-103113067 CAGGCACTGGCCAAGGCTGCGGG - Intergenic
1124195023 15:27617684-27617706 CTGGAACTGCATGATACTGCAGG - Intergenic
1124533078 15:30523066-30523088 CAGGAAGGGCAGGAGGCAGCAGG - Intergenic
1124765578 15:32484578-32484600 CAGGAAGGGCAGGAGGCAGCAGG + Intergenic
1125532193 15:40420963-40420985 TAGGAACAGCACTTGGCTGCAGG - Intronic
1125726293 15:41869995-41870017 CAGGAACTGCTGGAGACTGCAGG - Exonic
1126728085 15:51653411-51653433 CAGGCACTACAAGATGCTGCAGG + Intergenic
1127382224 15:58439944-58439966 CAGAAACAACACGAGGCTACAGG + Intronic
1128640027 15:69329104-69329126 CAGGCACTGCAAGGGGCTGGTGG + Intronic
1129681906 15:77662908-77662930 CAGGCACTGCAGGAGGCTCTGGG + Intronic
1130433637 15:83874400-83874422 CAGGAACTGAAGGAGACTCCGGG - Intronic
1131409403 15:92194234-92194256 CAGTAACTGCAAGAGCCAGCGGG + Intergenic
1131643191 15:94314050-94314072 GAGGAACTGCACGCCCCTGCTGG - Intronic
1132584304 16:699698-699720 CAGGACCTGCATGAGGCTCCAGG - Intronic
1135826359 16:25732102-25732124 CAGTAACTGGATCAGGCTGCTGG + Intronic
1137668901 16:50267847-50267869 CAGGAAGTGCAGGAGGCTGAGGG + Intronic
1140031832 16:71345222-71345244 GCGGAACTCCTCGAGGCTGCCGG - Intergenic
1141096276 16:81165313-81165335 CAGGAGCTGGACAATGCTGCTGG - Intergenic
1142303871 16:89274849-89274871 CAGCGCCTGCACGATGCTGCTGG - Exonic
1143119242 17:4596919-4596941 CAGGATCTGCTTGATGCTGCTGG - Exonic
1143332803 17:6149845-6149867 CAGGCACTGCACTAGGCTCTGGG - Intergenic
1143616813 17:8056466-8056488 AGGGTACTGCAGGAGGCTGCTGG + Intergenic
1143918041 17:10309243-10309265 CAGGAGCTGCACGCGGTCGCTGG + Exonic
1144095234 17:11894447-11894469 GAGGAACTCCACGGGGCTGGCGG - Exonic
1145972975 17:28967770-28967792 CTGGAACTGTAGGAGGCTGGGGG + Intronic
1147987224 17:44313581-44313603 CAGGAACTGAAGGATGCTGCAGG - Intronic
1148839748 17:50487526-50487548 CAGGGACTGCACTGGGCAGCAGG + Intergenic
1150967415 17:69987516-69987538 GAGGAGCTGCCCGAGGCTGTGGG + Intergenic
1150968143 17:69995515-69995537 CAGGAGTTCCAAGAGGCTGCTGG + Intergenic
1151177083 17:72297608-72297630 CAGCAACTGAATGAGGCTGAAGG + Intergenic
1152039118 17:77891894-77891916 CAGCATCTTCAGGAGGCTGCTGG - Intergenic
1152384818 17:79966097-79966119 CAGGAACTGCCCGAAGCTGGGGG - Intronic
1153753033 18:8253254-8253276 ATGGGACTGCACCAGGCTGCTGG - Exonic
1153799579 18:8657639-8657661 CACGCACTGCCCCAGGCTGCAGG + Intergenic
1153869437 18:9303620-9303642 CAGCAAGTGTACCAGGCTGCAGG - Intergenic
1154189225 18:12214880-12214902 CAGGAACTCCCCCAGGATGCAGG - Intergenic
1154356955 18:13628664-13628686 CAGAAACTGCATAAGGATGCTGG + Intronic
1157131656 18:45013170-45013192 CAGGAATGGCAGGAGGCTGCAGG - Intronic
1157176834 18:45459617-45459639 CAGGAACTGGGCGAGGCCCCGGG - Intronic
1160596663 18:79980155-79980177 TAGGAGCTCCAAGAGGCTGCTGG + Intronic
1160906293 19:1453192-1453214 CAGCCACTGCACTGGGCTGCCGG - Intronic
1161678225 19:5665213-5665235 AAGGAACCCCACGAGGCTGATGG - Intronic
1162087916 19:8259656-8259678 AAGGAACTGCTCGAGGCAGCAGG + Intronic
1162573001 19:11483298-11483320 CAGGGGCTGTGCGAGGCTGCTGG + Intronic
1164783309 19:30910629-30910651 CAGGCCCTGCTCCAGGCTGCTGG - Intergenic
1165403989 19:35618957-35618979 CAGGAGCTGCAGGATGCAGCTGG + Exonic
1166123997 19:40702896-40702918 CAGGAGCTGCAAGGGGCAGCGGG - Intronic
1167431039 19:49454517-49454539 CAGGAACCCCACGAGGGTTCTGG - Intronic
1168098633 19:54129164-54129186 CAGGATCTCCAAGACGCTGCAGG + Exonic
928195838 2:29215929-29215951 GAGGCACTGCCCGAGGCTGCTGG - Intronic
928380055 2:30809915-30809937 CAGGCACTGCACCAGGCTCAGGG + Intronic
929090621 2:38213791-38213813 CAGGAAATGCATGATGCTACAGG - Intergenic
932620179 2:73260524-73260546 GAGAAACTGCATGCGGCTGCAGG - Exonic
933354235 2:81194643-81194665 CAGCGCCTGCACGATGCTGCTGG - Intergenic
933858391 2:86441265-86441287 CAGGAGCTGGGCGAGGCTCCGGG - Exonic
934913118 2:98277014-98277036 CAGGAACTGCCCGTGGAAGCTGG - Intronic
936448434 2:112615317-112615339 TAGGAACAGCACCAGTCTGCAGG - Intergenic
937253954 2:120541583-120541605 CAGCAGCTGAAGGAGGCTGCTGG + Intergenic
939187849 2:138881447-138881469 TAGGAATTGCATTAGGCTGCTGG - Intergenic
939955825 2:148527020-148527042 CAGGAACTGCCCCAGACTGAAGG - Intergenic
941716975 2:168774282-168774304 CAGGAACTCCAGGAGGCTGAAGG - Exonic
942930851 2:181490639-181490661 CAGGATCTGGACCAGGCTGCAGG + Intronic
942977225 2:182032512-182032534 CAGAAACTGCTCTAGGCTCCTGG - Intronic
945034171 2:205690013-205690035 CACAGAGTGCACGAGGCTGCCGG + Intronic
1170937312 20:20821580-20821602 CAGGAATTGCCCGGGGCTGGAGG - Intergenic
1170943742 20:20871067-20871089 CAGGCACTGCAGCAGGCTGGTGG - Intergenic
1171393716 20:24817565-24817587 CAGGAGCTGCCAGAGGCTGAGGG - Intergenic
1173706831 20:45116077-45116099 CAGGAACTGAATGAGGGTGATGG - Intergenic
1174762168 20:53216874-53216896 CAGGAGCTGCCAGGGGCTGCAGG - Intronic
1175897956 20:62347745-62347767 CAGGCTCTGCCGGAGGCTGCAGG + Intronic
1176111621 20:63413566-63413588 CAGGAACCGCATGACACTGCAGG + Exonic
1176250976 20:64119789-64119811 CAGGAACTCCACGTGCCTTCGGG - Intergenic
1179722675 21:43324505-43324527 CAGGAGCTGCAGGAGGCAGGAGG - Intergenic
1179908765 21:44437261-44437283 CAGGGGCTGCAGGGGGCTGCAGG - Intronic
1180107431 21:45629381-45629403 CAGGAACTGGCCATGGCTGCAGG + Intergenic
1180706902 22:17815787-17815809 GAGGAACTGGATCAGGCTGCAGG + Intronic
1180784114 22:18537359-18537381 CAGGAACAGCAGGAGGCTGTAGG + Intergenic
1181127681 22:20711408-20711430 CAGGAACAGCAGGAGGCTGTAGG + Exonic
1181241015 22:21476711-21476733 CAGGAACAGCAGGAGGCTGTAGG + Intergenic
1182347158 22:29674322-29674344 GAGGATCTGCACCAGGGTGCGGG + Intronic
1182973788 22:34603295-34603317 GAGGAACTGGAAAAGGCTGCTGG + Intergenic
1183482858 22:38074649-38074671 CAGGGAACGCAGGAGGCTGCAGG - Intronic
1183680002 22:39322636-39322658 CGGGTCCTGCACCAGGCTGCAGG + Intergenic
1183828425 22:40405653-40405675 CAGGAACAGCAGGAGGCAGGCGG - Exonic
1183947118 22:41332746-41332768 AAGGACCTGCCCAAGGCTGCAGG - Intronic
1184087539 22:42274228-42274250 CAGGCACAGCAGGAGGCTGTGGG - Intronic
949857565 3:8475823-8475845 CAGGCACTGGACCTGGCTGCAGG + Intergenic
962219349 3:133550708-133550730 GGGCAACTGCACAAGGCTGCAGG + Intergenic
962950706 3:140216003-140216025 TAGGAACTGCACGGGACAGCAGG + Intronic
963749650 3:149163246-149163268 GAGGAACTGCAGAAGGCTGTGGG + Intronic
968551927 4:1228324-1228346 CAGGTCCTGAACGAGGCTGTGGG - Exonic
969277973 4:6149825-6149847 CAGCAACTGCATCAGGCTGATGG + Intronic
969433405 4:7169313-7169335 TGGGACCTGCAGGAGGCTGCAGG + Intergenic
969475898 4:7422336-7422358 CAGGACCTAGAGGAGGCTGCAGG - Intronic
971560720 4:28077144-28077166 CAGGAAGTGCAAGAGGTTGGGGG + Intergenic
978748541 4:112222464-112222486 CCGGGGCTGCACGCGGCTGCAGG + Intergenic
979736405 4:124091271-124091293 CAGGAACTGGACATGGCTGTGGG + Intergenic
981079206 4:140622345-140622367 CAGGAACTGCTCGAAGGTGATGG + Exonic
981512655 4:145574526-145574548 CAGGAAGTGCAAGAGGTTGGGGG + Intergenic
985740271 5:1611798-1611820 CAGGAACAGCACGAGGCACTGGG - Intergenic
985834242 5:2259034-2259056 CAGGAGGTCTACGAGGCTGCAGG - Intergenic
986057947 5:4157752-4157774 CAGGAATTACTGGAGGCTGCTGG - Intergenic
986315674 5:6584854-6584876 CTGCAACTGCACGGGGCTGATGG - Intergenic
992516680 5:77501083-77501105 CAGGAAGTGCAAGGGGTTGCAGG + Intronic
995971247 5:117973904-117973926 CAGAAACTGCACAGGGCAGCAGG + Intergenic
996321587 5:122222796-122222818 CAGGAATGGCAAGATGCTGCCGG - Intergenic
999242844 5:150137548-150137570 CAGGAAATGGAGGAGGCTGTGGG + Intronic
1000777811 5:165441855-165441877 GTGGAACTGCCCAAGGCTGCAGG - Intergenic
1001041376 5:168337965-168337987 CAGGACCTGGAGGAGGCTGGAGG + Intronic
1001551967 5:172609363-172609385 CTCGCACTGCACGAGGCTGGTGG + Intergenic
1002904148 6:1435328-1435350 CAGGAACTGTAAGAAGCTGCTGG + Intergenic
1004883564 6:20031651-20031673 AAGGAACTGCACGCAGCTTCTGG + Intergenic
1006385966 6:33731135-33731157 CAGGAACTGCACGAGGCTGCTGG - Intronic
1007212412 6:40206072-40206094 CAGGAATGGCAAGATGCTGCGGG + Intergenic
1007257800 6:40540916-40540938 CAGAGGCTGCAGGAGGCTGCTGG + Intronic
1010734724 6:79431154-79431176 CAGGAACAGCTTGAGGCTGAGGG - Intergenic
1015553397 6:134435540-134435562 CTGGAACTACAAGATGCTGCAGG - Intergenic
1016053685 6:139556177-139556199 CATGAACAGCAAGTGGCTGCAGG - Intergenic
1016265890 6:142232346-142232368 CAGGAAGTGCAAGGGGCTGGGGG + Intergenic
1018732793 6:166665421-166665443 CAGCAGCTGCACAAAGCTGCTGG + Intronic
1019087898 6:169499404-169499426 CTGGAACTGTGTGAGGCTGCTGG - Intronic
1019410115 7:903046-903068 CAGGAACCAGATGAGGCTGCAGG + Intronic
1019752007 7:2736677-2736699 CAGAAACTGCTGAAGGCTGCAGG - Intronic
1020964738 7:14850872-14850894 CAGAAACTGAATGAGGATGCAGG - Intronic
1022965394 7:35467058-35467080 GAGAAACAGCAAGAGGCTGCTGG + Intergenic
1023703137 7:42912042-42912064 CAGGAGGTGCCCGAGGCGGCGGG - Exonic
1023870405 7:44260317-44260339 CAGGAACTCCATGTGGCTTCTGG + Intronic
1023893787 7:44414966-44414988 CAGTGACTGCACCAGCCTGCAGG + Intronic
1023921853 7:44636110-44636132 CATGAACTGCATGAGGATTCGGG - Intronic
1025150159 7:56541260-56541282 GAGGACCTGCACCAGGCTGGGGG + Intergenic
1026961594 7:74411718-74411740 GAGCAACTGCACTAGACTGCAGG + Intergenic
1029064525 7:97836131-97836153 CAGGAACTGCACTAGACTTTGGG + Intergenic
1032481038 7:132247437-132247459 AAGAAACTCCAAGAGGCTGCTGG + Intronic
1032710419 7:134456083-134456105 AAGGAACTGCACCTGCCTGCAGG + Intronic
1032739080 7:134721070-134721092 CAGGAACAGCCCCAGGCTGTTGG - Intergenic
1035217914 7:157383737-157383759 CAGGAGCTACACGTGGCTGGTGG - Intronic
1035239922 7:157523003-157523025 CAGGAGCTGCCGGAGGCTGCGGG - Intergenic
1035291403 7:157841574-157841596 CAGTAATTACCCGAGGCTGCTGG + Intronic
1036969698 8:13341362-13341384 CAAGAACTGCTCGAAGCTGAAGG - Intronic
1041281892 8:56218942-56218964 CAAGAACTGCAGTTGGCTGCCGG + Intergenic
1045678343 8:104632867-104632889 CAGGCACTGCACGGGACTGGTGG - Intronic
1045799830 8:106089357-106089379 AAAGACCTGCAAGAGGCTGCTGG - Intergenic
1047981368 8:130186598-130186620 CAAGAACTCCACGAGGTTGGTGG + Intronic
1048695013 8:137017793-137017815 GAGGAACAGGAGGAGGCTGCAGG - Intergenic
1048829394 8:138461254-138461276 CAGGAAGTGGACCAGGGTGCTGG + Intronic
1052904052 9:33817987-33818009 CAGGAACTGCAGAAAGCGGCGGG - Intronic
1053015958 9:34662308-34662330 GTGGAACTGCAGGAGGCTGACGG - Exonic
1053020559 9:34691200-34691222 CAGGATCTGTGTGAGGCTGCAGG + Exonic
1053312546 9:37028576-37028598 CAGGAACTGCCAGAGGCTTTGGG + Intronic
1055562134 9:77531475-77531497 CAGGGACTCCAAGATGCTGCAGG - Intronic
1059934046 9:119290011-119290033 CAGGAACTGGTCAAGTCTGCAGG + Intronic
1060153030 9:121300705-121300727 CAGGGTCTGCAGGAGGCTGTTGG - Intronic
1060781279 9:126415120-126415142 CAGGAGCTGCACTAGGCCACTGG - Intronic
1062524587 9:136973113-136973135 CAGAAACTGCCCTAGGCTGGAGG + Intergenic
1185643665 X:1601634-1601656 CAGGACCTGCTCGAGCCTCCTGG + Exonic
1186091486 X:6053398-6053420 CTGGAACTCCACGAGCATGCTGG + Intronic
1187473598 X:19590290-19590312 CAGGAACTCCAGCAGCCTGCTGG + Intronic
1189408214 X:40744761-40744783 CAGGAGCTGCCCAAGGCTGTGGG - Intergenic
1190846391 X:54195828-54195850 AAGGCACTGCAAGAGTCTGCAGG + Exonic
1191253853 X:58271428-58271450 CAGGTGGGGCACGAGGCTGCTGG + Intergenic
1196022529 X:111005434-111005456 CAGGAAATGCAAAAGCCTGCTGG + Intronic
1197695998 X:129551321-129551343 CAGGAACTACACTAGGCTCTAGG + Intronic
1199336012 X:146619901-146619923 CAGCACCTGCACGATGCTGCTGG - Intergenic
1200756482 Y:6995021-6995043 CAGGAGCTGCAAGAGCATGCAGG - Intronic
1201962765 Y:19700141-19700163 CAGACACTGCAGAAGGCTGCAGG - Intergenic