ID: 1006387434

View in Genome Browser
Species Human (GRCh38)
Location 6:33739166-33739188
Sequence CAGGCTGCACTGAAGGCCCA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 322
Summary {0: 1, 1: 0, 2: 4, 3: 27, 4: 290}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006387434_1006387440 9 Left 1006387434 6:33739166-33739188 CCCTGGGCCTTCAGTGCAGCCTG 0: 1
1: 0
2: 4
3: 27
4: 290
Right 1006387440 6:33739198-33739220 AGTGGAAACTCCCTTGCCCCTGG 0: 1
1: 0
2: 1
3: 13
4: 170
1006387434_1006387438 -9 Left 1006387434 6:33739166-33739188 CCCTGGGCCTTCAGTGCAGCCTG 0: 1
1: 0
2: 4
3: 27
4: 290
Right 1006387438 6:33739180-33739202 TGCAGCCTGTGGCACAGCAGTGG 0: 1
1: 1
2: 2
3: 46
4: 357
1006387434_1006387445 24 Left 1006387434 6:33739166-33739188 CCCTGGGCCTTCAGTGCAGCCTG 0: 1
1: 0
2: 4
3: 27
4: 290
Right 1006387445 6:33739213-33739235 GCCCCTGGACTTGGACGGATTGG 0: 1
1: 0
2: 0
3: 2
4: 93
1006387434_1006387441 15 Left 1006387434 6:33739166-33739188 CCCTGGGCCTTCAGTGCAGCCTG 0: 1
1: 0
2: 4
3: 27
4: 290
Right 1006387441 6:33739204-33739226 AACTCCCTTGCCCCTGGACTTGG 0: 1
1: 0
2: 1
3: 20
4: 164
1006387434_1006387443 19 Left 1006387434 6:33739166-33739188 CCCTGGGCCTTCAGTGCAGCCTG 0: 1
1: 0
2: 4
3: 27
4: 290
Right 1006387443 6:33739208-33739230 CCCTTGCCCCTGGACTTGGACGG 0: 1
1: 0
2: 3
3: 18
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006387434 Original CRISPR CAGGCTGCACTGAAGGCCCA GGG (reversed) Exonic
900393007 1:2441901-2441923 GAGGCTTCACTGCAGGCTCATGG + Intronic
900623518 1:3598056-3598078 CAGGCTGCAGGGCAGGCCCGGGG - Intronic
900625543 1:3606965-3606987 CAGGCTGCACAGCAGGCCCCAGG - Intronic
901193322 1:7425497-7425519 GAGGCTGCTCTGAAGGACCCTGG - Intronic
901630032 1:10643506-10643528 CAGGCTGGAGAGGAGGCCCAGGG - Intronic
902174182 1:14637048-14637070 CAGGCTGCCCAGAGAGCCCAGGG + Intronic
902410249 1:16207908-16207930 CTGGCTGCCCTCAGGGCCCATGG + Intronic
903235601 1:21948792-21948814 CATGCTCCACTGTGGGCCCAGGG + Intergenic
904001073 1:27339115-27339137 CAGGGAGCACAGAAGGCCCAGGG + Intergenic
904094411 1:27966181-27966203 CAGGATGCAGCCAAGGCCCAGGG + Intronic
904895797 1:33817180-33817202 TGGGCTTCCCTGAAGGCCCAGGG - Intronic
904906327 1:33899861-33899883 CAGGCAGCCCTGAGGTCCCAGGG - Intronic
907251200 1:53141118-53141140 CAGGCTGAAGACAAGGCCCAAGG - Intronic
907269476 1:53282436-53282458 CACCCTGCACTGCAGCCCCAAGG - Intronic
910243094 1:85109579-85109601 CAGGATGCAGTGCAGGCCCAGGG + Intronic
911536451 1:99106112-99106134 CAGGGTTCCCTTAAGGCCCAAGG - Intergenic
912225544 1:107729547-107729569 CATGGTGCACTGAAGGGGCATGG + Intronic
912680816 1:111727649-111727671 CAGGCAGCCCTGAAGGTCCCAGG - Exonic
912840341 1:113033745-113033767 CAGACTGTTCTCAAGGCCCATGG + Intergenic
914000832 1:143692753-143692775 CAGGCTACACTGCAGGGCCTGGG + Intergenic
914510796 1:148330115-148330137 CAGGCTGGACTGCAGGGCCTGGG + Intergenic
914513641 1:148355025-148355047 CAGGCTGGACTGCAGGGCCTAGG + Intergenic
915186132 1:154106493-154106515 CAGTGTTCACTCAAGGCCCAAGG - Intronic
915345394 1:155194540-155194562 CAGGCTGCGCTCTAGGCCGACGG + Intergenic
915647660 1:157285457-157285479 TAGGCTGAGCTGAAGGCCGAGGG - Intergenic
915741896 1:158125168-158125190 CAGGCTGCACTGTAAGCTTATGG - Intergenic
916090430 1:161304823-161304845 GAGGCTGCACTGCAGCCACAGGG - Exonic
916192900 1:162196553-162196575 CAGGCTGCAGTGAAGTAGCAGGG + Intronic
920498469 1:206471563-206471585 CAGGCTGAAATCAAGGCCAAGGG - Intronic
921987393 1:221327071-221327093 CTGGCTGCTCTGCAGGCACATGG - Intergenic
1062864184 10:835998-836020 CAGGCTGCACTGGTGGCTCAGGG + Intronic
1063056029 10:2505340-2505362 CAGGTTGCACTGCAGAACCAGGG + Intergenic
1065592794 10:27282798-27282820 CAGGCATCAGTGAAGGCCAATGG - Intergenic
1065657571 10:27967486-27967508 CAGGCATCAGTGAAGGCCTATGG + Intronic
1067439450 10:46300406-46300428 CAGGCTGGATAGGAGGCCCAGGG - Intronic
1067741401 10:48898361-48898383 CCAGCTGCCCTGGAGGCCCAGGG - Intronic
1068160365 10:53254664-53254686 CAGGCTGCACTGGAGGCACATGG - Intergenic
1068759236 10:60689352-60689374 CAGGCTGCACTGCAGTGGCATGG - Intronic
1069792761 10:71033798-71033820 CATGCTGCCCTGGAGGCTCAGGG - Intergenic
1069828506 10:71268732-71268754 CATGCCGCCCTGAAAGCCCAGGG - Intronic
1074002979 10:109390844-109390866 CAGGCTTCTCTGAGGCCCCAGGG - Intergenic
1074821069 10:117178905-117178927 CAGGCAGCACTGCAGTCACATGG + Intergenic
1076003171 10:126928343-126928365 CGGGCTCCACTGAAGTCCCTGGG - Intronic
1076233164 10:128838731-128838753 CAGGCTGCCCTGAAGAGCGATGG - Intergenic
1076747777 10:132523018-132523040 CAGGCTGCTCTGAAGGTGCTGGG - Intergenic
1076866166 10:133167448-133167470 CAGGCTGCACTCCAGGCACACGG - Exonic
1077144180 11:1037338-1037360 CAGGCTGCCCTGGAGGCCTGAGG + Intergenic
1077408317 11:2392363-2392385 CAGGCTGTGCTGAGGCCCCATGG + Intronic
1078014092 11:7597680-7597702 GCGGGTGCACTGAAGGCCCTTGG + Intronic
1078548401 11:12263127-12263149 CAGCCTGCACTGTAGACCCAAGG + Intronic
1079356606 11:19735204-19735226 CAGGCTTCACCCAAAGCCCATGG - Intronic
1079650483 11:22922343-22922365 CAGGCTGCCCTCAAGCCCCTGGG + Intergenic
1081763426 11:45592770-45592792 CAGGCAGCCCAGAAGGGCCACGG + Intergenic
1084236762 11:67792708-67792730 CCTGCTGCACTGTAAGCCCAGGG + Intergenic
1085058028 11:73419281-73419303 CAAGCTGCACTGTGGGACCAAGG - Intronic
1085259396 11:75195694-75195716 CAGGCTGCAGAGGAGGCCAAAGG - Intronic
1089770210 11:120797132-120797154 CAGTGTGCACTGAGGCCCCATGG + Intronic
1090218306 11:124991372-124991394 TAGGCTTCATTGAAGGCCAAAGG - Intronic
1091234141 11:134008481-134008503 AAGGCTGCTCTGATGGCACAGGG + Intergenic
1091329152 11:134717006-134717028 CAGGCTCCAGTGAAGGATCATGG + Intergenic
1091389425 12:117064-117086 TAGGCTGTACTGAAGCCACAGGG + Intronic
1093211851 12:16317448-16317470 CAGAGTGCACTGAAGGATCAAGG - Intergenic
1093920187 12:24850788-24850810 GTGGCTGCACTGAAGTCACAGGG + Intronic
1094528955 12:31254163-31254185 CAGGCTGCACTGAAACGCCCTGG - Intergenic
1098736556 12:74112527-74112549 CAGTGTTCACTTAAGGCCCAAGG + Intergenic
1100356324 12:93834134-93834156 CTCCCTGCACTGCAGGCCCATGG - Intronic
1101660896 12:106764795-106764817 CAGTCTGCACTGATGGACCAGGG + Intronic
1101680428 12:106958819-106958841 CAGGCTGCTCTCAAACCCCAGGG + Intronic
1103331857 12:120159787-120159809 CTGGCTGCAGGGATGGCCCAGGG - Intronic
1104709282 12:130974053-130974075 GAGGCTGAACTCAAGACCCAGGG - Intronic
1105214173 13:18274669-18274691 CAGTCTGCACTCAGGGCCCCAGG - Intergenic
1105840691 13:24251561-24251583 CAGGCTGCACCGAAGCCCAGTGG - Intronic
1105904110 13:24787502-24787524 CAGGCTGATCTCAAGGCTCAGGG - Intronic
1106961373 13:35002255-35002277 CAGAGAACACTGAAGGCCCAGGG - Intronic
1107800971 13:44107692-44107714 CATGCTGCACAGCAGGCTCAGGG + Intergenic
1108147220 13:47491271-47491293 CAAACTGCACTGGAGGCACAGGG + Intergenic
1111933368 13:94534595-94534617 CAGGGTCCACTGAAAGCCTATGG - Intergenic
1112579964 13:100669989-100670011 CTGGCTGTAATGAAGGCTCAGGG + Intronic
1113181991 13:107639563-107639585 CAGGCTGCAATCAGGGCACAGGG - Intronic
1113424698 13:110198476-110198498 CAGGCTGCCCAGGGGGCCCAGGG + Exonic
1114598372 14:23933789-23933811 GAGGCTGACCTGAAGGCCCTGGG - Intergenic
1114736679 14:25049866-25049888 CAGGCTGCACGGTAGGACCGGGG - Exonic
1117161400 14:52994008-52994030 CAATGTTCACTGAAGGCCCAAGG + Intergenic
1118323207 14:64765271-64765293 CAGGCTGCACTGGGGGCCAAGGG - Intronic
1119217431 14:72879812-72879834 CTGGATGCCCTGGAGGCCCATGG - Intronic
1119966593 14:78923127-78923149 GAGGCAGCACTCAAGGCCAAAGG - Intronic
1120782052 14:88494184-88494206 CAGGCTGCAATGAGGGAGCAAGG + Intronic
1120915436 14:89706208-89706230 CAGGCTGTACAGAAGGCCTCAGG + Intergenic
1121293002 14:92793059-92793081 CAGGATGCACTGCAGTCGCATGG + Intergenic
1121593070 14:95135100-95135122 GAGGCCACTCTGAAGGCCCAAGG + Intronic
1122417091 14:101555166-101555188 GATGCTACACTGCAGGCCCAGGG - Intergenic
1122481312 14:102049285-102049307 CAGGCTGCACTTTATGCCCCTGG - Intronic
1122794684 14:104200229-104200251 CAGGCTGCACAGTAGGCAGATGG - Intergenic
1122852641 14:104545358-104545380 CTGGCTGTACTGATGGCCCAAGG + Intronic
1122980804 14:105191674-105191696 CAGGCTGCCCTGGTGTCCCAGGG - Intergenic
1123113157 14:105882337-105882359 CAGGCTGCGGGGAAGGACCAGGG - Intergenic
1123115507 14:105892489-105892511 CAGGCTGCGGGGAAGGACCAGGG - Intergenic
1123119756 14:105911205-105911227 CAGGCTGCAGGGAAGGACCAGGG - Intergenic
1123739964 15:23226523-23226545 CAGGCTCCACAGCAGTCCCAAGG + Intergenic
1124291188 15:28455491-28455513 CAGGCTCCACAGCAGTCCCAAGG + Intergenic
1124375563 15:29126888-29126910 CTGGCTGCACTCCAGGCCCGGGG - Intronic
1126015707 15:44348369-44348391 CAGTGTTCACTTAAGGCCCAAGG - Intronic
1126696615 15:51331247-51331269 CAGGCAGCACTGAACACCCGAGG + Intronic
1127382024 15:58438515-58438537 CAGGCTGGACTTCAGTCCCAAGG + Intronic
1127905159 15:63370988-63371010 CAGGCTGCAGTGAGAGCTCAGGG - Intronic
1128237312 15:66077140-66077162 CAGGCTGGACTGGTGGGCCAGGG - Intronic
1128760000 15:70210144-70210166 CCTGCTGCACTGAAAGCCCTGGG - Intergenic
1129561796 15:76578029-76578051 CAGTGTTCACTCAAGGCCCAAGG - Intronic
1130296445 15:82649513-82649535 GCGACAGCACTGAAGGCCCAAGG + Intergenic
1131818753 15:96249847-96249869 CAGGGCACACTGAAGGCCCTTGG + Intergenic
1132104477 15:99052931-99052953 CAGGCTGCAGTGAAGTGCAATGG - Intergenic
1132400492 15:101502045-101502067 CAGGCTGCACTGTTGCCCCCTGG + Intronic
1132715619 16:1288659-1288681 CAGGCTCCACTCATGGCCCAAGG + Intergenic
1132753636 16:1471136-1471158 CAGGCAGCTCTGAAGGGCCTGGG + Intronic
1133139285 16:3732409-3732431 CGGGGTCCACTCAAGGCCCACGG + Intronic
1133190740 16:4131853-4131875 CAGCCTGCATTGAAGCCCCACGG - Intergenic
1140021480 16:71243087-71243109 CAGGCCGCACTGATGGGCAAAGG + Intergenic
1140953958 16:79845300-79845322 CCTGCTGCACTGATGCCCCATGG - Intergenic
1141678555 16:85530615-85530637 CAGCCTGCAACGAGGGCCCAGGG + Intergenic
1143779829 17:9223617-9223639 CAGGGGACACTGAAGACCCAGGG - Intronic
1144661942 17:17076581-17076603 GAGGCTGCACATAAGGCCCTTGG + Intronic
1146054775 17:29575599-29575621 CAGGCTGGACTGGAGACCCAGGG + Intronic
1150049486 17:61946981-61947003 CAGATTGCACTGAAGGCACGTGG + Exonic
1151259376 17:72904681-72904703 CAGGTGGCACTGACGGGCCAAGG + Intronic
1151715087 17:75827198-75827220 CAGGCCCCACTGTAGGCCAAAGG + Intergenic
1152243101 17:79170375-79170397 CAGGCTGGGCTGCAGGCCCCTGG - Intronic
1152424846 17:80213353-80213375 CATGCTCCCCTGAAGGCCTAGGG - Intronic
1152468142 17:80476988-80477010 CTGGCTGCACTGAACACCCTTGG + Intronic
1152583377 17:81178754-81178776 CCCGCTGCACTGGAGGCCCGAGG + Intergenic
1152726308 17:81948425-81948447 CAGGCTGTCCTGCAGGACCAGGG - Intergenic
1153363345 18:4224526-4224548 CAGTGTTCACTCAAGGCCCAAGG - Intronic
1153677829 18:7471110-7471132 CAGGATACACTGAAGGCAAAAGG + Intergenic
1153821783 18:8838370-8838392 CAGAGTGCACTAAAGACCCATGG - Intergenic
1154149561 18:11895581-11895603 CAGGCTGGACTGCAGTGCCATGG + Intronic
1155628373 18:27862402-27862424 CAAGCTGCACTGCACTCCCATGG - Intergenic
1156055633 18:32999163-32999185 CAGTCTTCACTCAAGGCCCAAGG - Intronic
1157197551 18:45631659-45631681 CAGGCTGGACTGGAGGGCAATGG + Intronic
1157576921 18:48749856-48749878 CAGGCTGTAGTGAGGGTCCATGG + Intronic
1160550381 18:79691268-79691290 CAGGCTGCGCTGGTGGCCCAAGG + Intronic
1161108177 19:2454933-2454955 CAGTCTGCACTGAAGCCTCGGGG + Intronic
1162494286 19:11014423-11014445 CAGACTGCTCTGAAGGAGCAGGG + Intronic
1162762589 19:12897377-12897399 CAGGCAGGCGTGAAGGCCCAGGG - Exonic
1162936681 19:13984758-13984780 CCGGCAGGACTGAAGGGCCACGG + Intronic
1163455653 19:17404397-17404419 CTGGATGCAGAGAAGGCCCAAGG - Exonic
1164097052 19:22021070-22021092 CAGCCTGCACTGATGACCTAAGG - Intergenic
1164686774 19:30172074-30172096 CAGCCTCTGCTGAAGGCCCACGG + Intergenic
1165061378 19:33206833-33206855 CAGGGTGACCTGAGGGCCCATGG + Intronic
1165569931 19:36767190-36767212 CAGGCTGCAGTGCAGTGCCACGG - Intronic
1165849890 19:38843647-38843669 CAAGCAGCAGTGAAGACCCATGG + Intronic
1166991527 19:46695678-46695700 CAGGCGGGACAGAAGGCACAGGG + Intronic
925007269 2:453442-453464 CAGCCTGCACCGAAGGCCCATGG - Intergenic
926959896 2:18345284-18345306 CAGGTTGCACTGGAGGCAAAAGG + Intronic
927387006 2:22546239-22546261 CAGGCTCCAATGCAGGCCCAAGG + Intergenic
927467814 2:23350387-23350409 CAGGGTTCCCTGAAGGCCCCCGG + Intergenic
928169508 2:28994344-28994366 CCAGCTGCCCTGAAAGCCCATGG - Intronic
928383916 2:30847525-30847547 CAGTGTTCACTCAAGGCCCAAGG - Intergenic
928685989 2:33749201-33749223 GAGACTGCTCAGAAGGCCCACGG + Intergenic
930301459 2:49621093-49621115 CAAACTGAACTGAATGCCCAGGG - Intergenic
930312811 2:49763268-49763290 CAGTCTGCACTAAAGCCACACGG - Intergenic
931056844 2:58482001-58482023 CAGGTGTCACTGAAGGCCCAGGG - Intergenic
933777107 2:85777779-85777801 CAGGCTCCACTGGAGGCTCTGGG - Intronic
934300146 2:91772081-91772103 CAGTCTGCACTCAGGGCCCCAGG + Intergenic
934985370 2:98881249-98881271 CAGGCTGCACTTGAGGGGCAGGG - Intronic
936147261 2:109988168-109988190 CAGGCACCACCGAAGGCACACGG + Intergenic
936197431 2:110383315-110383337 CAGGCACCACCGAAGGCACACGG - Intergenic
937258354 2:120570155-120570177 CAGGCTGCTGAGAAGGCCCTGGG + Intergenic
941697526 2:168569560-168569582 CAGGCTGAACTGAATGGCCTAGG - Intronic
943455548 2:188102979-188103001 GAGGCTGCACTGCAGGACAAGGG - Intergenic
944923313 2:204437734-204437756 CATGATGGACTGAATGCCCATGG + Intergenic
945195903 2:207237606-207237628 CAGGCTGGTTTGAAGGACCAGGG - Intergenic
947524536 2:230870172-230870194 CAGGCTGCTTTGAGGGCCAAAGG + Intronic
947819990 2:233062776-233062798 CAGGCTCCACTGTAGGCCGTGGG + Intronic
948384646 2:237573990-237574012 CAGGCTGCACAGGATGCACAGGG - Intergenic
948766938 2:240227233-240227255 CAGCCTGCACTGGAGGCCTCAGG - Intergenic
948817904 2:240522618-240522640 CTGGCTGCACTGAAGCCCACGGG + Intronic
1168828498 20:830803-830825 CAGGCTGGTCTGAAGCCCCTGGG + Intergenic
1173169546 20:40713005-40713027 CAGGCTGGGCTGCAGGCCTAGGG - Intergenic
1173828138 20:46060412-46060434 CAGGCTGCACTGATACCCCCAGG + Intergenic
1174058506 20:47816129-47816151 AAGGCTGAACTGGAGACCCAGGG + Intergenic
1174159825 20:48542889-48542911 AAGGCTGAACTGGAGACCCAGGG - Intergenic
1174309018 20:49635942-49635964 CAGGCTCCACGGCAGGACCACGG + Exonic
1174418887 20:50386310-50386332 GATGCTGCACAAAAGGCCCATGG - Intergenic
1174929060 20:54793775-54793797 GTGGCTGCACTGTGGGCCCAGGG + Intergenic
1175889642 20:62310515-62310537 GAGGCTGCACGGGAGGCCCCTGG - Exonic
1176159361 20:63640716-63640738 CAGGCTTCCAGGAAGGCCCAGGG + Exonic
1177394570 21:20515585-20515607 CAGGCTGCAGTGGATCCCCACGG - Intergenic
1177961572 21:27673275-27673297 AAAGCTGTACTGAAGGCACATGG - Intergenic
1178497728 21:33101462-33101484 CGGGCTGCCCTGCCGGCCCATGG + Intergenic
1179175542 21:39005348-39005370 CACGCTCCCCTGAAGGCTCAGGG + Intergenic
1179784623 21:43722373-43722395 GAGGCTGCCCTGAGGGCCCCAGG - Intronic
1179808398 21:43854612-43854634 CTGGGTGCACAGAAGGGCCAAGG + Intergenic
1180024679 21:45153718-45153740 CACGGTGCACAGAGGGCCCAGGG - Intronic
1180038529 21:45263728-45263750 CAGGCCACACTGGGGGCCCAGGG + Intergenic
1180110386 21:45644640-45644662 CAGGCTGCTCTGAAGGACGGTGG - Intronic
1181287679 22:21766140-21766162 CAGGCAGCACCGCAGGCACAAGG - Intronic
1181555876 22:23671442-23671464 CAGTCTGCACTCAGGGCCCCAGG - Intergenic
1181698501 22:24607211-24607233 CAGTCTGCACTCAGGGCCCCAGG + Intronic
1181736356 22:24884697-24884719 AAGGCTGCCCTGAAGGGCCCTGG - Intronic
1181778871 22:25178688-25178710 CAGGCTTCCAGGAAGGCCCAGGG + Intronic
1183279149 22:36922904-36922926 CAGGCTGCACAGTCGGTCCAGGG + Intronic
1184288639 22:43486464-43486486 CAGGCTCCTCTGAAAGCTCAGGG + Intronic
1184334838 22:43847076-43847098 CAGGCTGGAGAGAAGGGCCACGG - Intronic
1184458525 22:44624695-44624717 CAGGCTCCTCTGAGGGCTCAGGG - Intergenic
949894131 3:8756807-8756829 CGGGCTTCTCTGAAGGGCCATGG + Intronic
950434543 3:12970897-12970919 CAGGCTCCACTGTCGGCACAGGG - Intronic
950550634 3:13663970-13663992 CAGGCTGCCCCGATGGCTCAGGG + Intergenic
950591087 3:13936014-13936036 CAGGCTGCATTGGATGCCCTGGG + Intergenic
952974034 3:38679047-38679069 CAGGATGCCCAGAAGGACCAAGG + Intergenic
954880280 3:53831095-53831117 CAGCATTCACTTAAGGCCCAAGG - Intronic
955150772 3:56364817-56364839 CAGGCAGTACTGAGTGCCCAGGG - Intronic
956124285 3:65996822-65996844 CACCCTGAACTGAAGGCCCCGGG + Intronic
957578792 3:82043940-82043962 GTGGCTGCAGTGAAGGCCAATGG - Intergenic
957925489 3:86805397-86805419 CCACCTGCACTGCAGGCCCATGG - Intergenic
958615868 3:96493306-96493328 CTTGCTGCACTGGAGGGCCAAGG + Intergenic
959474392 3:106791166-106791188 CAGTGTTCACTTAAGGCCCATGG - Intergenic
960244380 3:115383287-115383309 CAAGCTCCTCTGAAGGTCCATGG + Intergenic
961543724 3:127617884-127617906 CAGGCTGCTCTGATGGCAGAAGG - Intronic
961659102 3:128458946-128458968 CACGCGGCACTCAAGGCCCAGGG - Intergenic
961799191 3:129431939-129431961 AAGCCTGAACTGAAGGACCATGG - Intronic
964679203 3:159318631-159318653 CAGCCTGCACTGATGGCCTCAGG - Intronic
965253200 3:166369004-166369026 CAGGCTACAGCTAAGGCCCAAGG - Intergenic
966151716 3:176873822-176873844 CAATGTTCACTGAAGGCCCAAGG - Intergenic
967319410 3:188180404-188180426 CATGCTGCCCTGATGGCCCAAGG + Intronic
968496348 4:919393-919415 CATGCGGCACTGAAGGCCTTTGG - Intronic
968576041 4:1366656-1366678 CAGGCTGCAGGGAGGGCCCCAGG - Intronic
968881038 4:3300346-3300368 CAGGCTGGACTCCAGGCCCCTGG - Intronic
969148180 4:5142447-5142469 CAGACTTCACTGTAGGCACATGG + Intronic
969298708 4:6284861-6284883 CACGCTGCTCTGTGGGCCCATGG + Intronic
969491871 4:7504074-7504096 CAGGCTGCAGTGAGTGACCAGGG - Intronic
969725096 4:8914011-8914033 CAGGCTCCCCTGCAGGCACAAGG - Intergenic
970205909 4:13655212-13655234 CAGGCTGGACAGAAGTTCCAGGG - Intergenic
975675202 4:76821028-76821050 CAAGGTTCACTCAAGGCCCAAGG + Intergenic
980035872 4:127881619-127881641 CAGGCTGGACTGGAAGCTCAGGG - Intronic
980097930 4:128512333-128512355 CAGACTGCCCTGAGGGCCAAGGG + Intergenic
980167936 4:129251385-129251407 CAGGCTGTACAGGAAGCCCATGG - Intergenic
981835037 4:149044224-149044246 CAGCCTGCACTGATGGCTAATGG + Intergenic
983267693 4:165524476-165524498 GAGGCTAAAGTGAAGGCCCAAGG + Intergenic
986357525 5:6943273-6943295 CAGCCTGCAGTGAAAGACCAAGG - Intergenic
988589744 5:32538433-32538455 CAGGCTGCCGTGGAGGCTCAGGG + Intronic
990577894 5:57141033-57141055 CAGGCTGCACTGCAGTGGCATGG + Intergenic
991693744 5:69250497-69250519 CAGTGTTCACTTAAGGCCCAGGG + Intronic
993060312 5:83030469-83030491 CAGTGTTCACTCAAGGCCCAAGG - Intergenic
995019561 5:107351861-107351883 CAGTGTTCACTCAAGGCCCAAGG + Intergenic
996186306 5:120480076-120480098 CAGGCTGCATTGTATGCCCTTGG + Intronic
996312518 5:122122820-122122842 GAGGCTGAATTGAGGGCCCATGG - Intergenic
997633418 5:135386975-135386997 CAGGCTGCTGTGAAGGCCAAAGG - Intronic
997849181 5:137315593-137315615 CCTGCTGCACTGATGGCTCAAGG + Intronic
997965361 5:138352505-138352527 CAGGGGGCACTGCAGGCCCCGGG + Intergenic
998041503 5:138953563-138953585 CAGGCTGCTCTGCAGACACAGGG - Intronic
998132475 5:139658415-139658437 CAGGCTGCCCTGAGGTCACAGGG + Intronic
1000978575 5:167792207-167792229 GAGGCTGTAATGAAGGCTCAGGG - Intronic
1001054045 5:168434867-168434889 CAGGCCCCACTGACGTCCCATGG + Intronic
1002495708 5:179610127-179610149 CAGGCTGCCCTGCAGGCTCTGGG - Intergenic
1003192078 6:3883116-3883138 CAGGAGGCACAGAAGGCACAGGG - Intergenic
1005671902 6:28114775-28114797 CAGGTTGCCCTGAAGGCCTCTGG - Intergenic
1005997651 6:30941031-30941053 GAGGCAGCACTGGAGGCCAAAGG - Exonic
1006014892 6:31072615-31072637 CAGGCTCCACTAAAGACCTAGGG - Intergenic
1006387434 6:33739166-33739188 CAGGCTGCACTGAAGGCCCAGGG - Exonic
1006988628 6:38194141-38194163 CAGGCTCCCCTGCCGGCCCATGG - Intronic
1007270329 6:40631167-40631189 CAGGATGCAATGAAGACCCCGGG + Intergenic
1007293911 6:40806694-40806716 CAGGCTGCACAGAGGGCCTGGGG + Intergenic
1007679575 6:43625074-43625096 CAGGAGGCACTGAGGGCCCTGGG - Intronic
1012435934 6:99215389-99215411 CCGGCTGCAGTCAAGGCACAGGG + Intergenic
1013086387 6:106861381-106861403 CAGGCTTCACTGAAGCCTGAAGG + Intergenic
1018012932 6:159688194-159688216 CAGCCTGCACTGAAGTTCAATGG - Exonic
1018197613 6:161368734-161368756 CAGGCAGCAGCGATGGCCCAGGG - Intronic
1018386980 6:163313673-163313695 CAAGTTGCACTGAAGGTCCCTGG + Intronic
1018435670 6:163756582-163756604 CAGGCTGGAGTGAAGTGCCAAGG + Intergenic
1018834192 6:167470988-167471010 CAGGCAGGACTGAGGGCCCTTGG + Intergenic
1019409752 7:901327-901349 TAGGCTGAACAGGAGGCCCAGGG - Intronic
1019444616 7:1064857-1064879 CAGGGCGCACAGAAGGCCCCAGG + Intronic
1019779012 7:2928973-2928995 CAGGCTGAGCTCAAGGCCCCCGG + Intronic
1020014038 7:4820751-4820773 CAGGCTGGACTGAGGGCGCGTGG - Intronic
1020040268 7:4996286-4996308 CAGGGTGCAGCCAAGGCCCAGGG + Intronic
1020101648 7:5397329-5397351 CAGGCTGCACGGAAGCCTAATGG + Intronic
1021698411 7:23295280-23295302 CAGGCTGGGCCAAAGGCCCAAGG - Intergenic
1023716286 7:43047291-43047313 CAGTGTTCACTCAAGGCCCAAGG - Intergenic
1024230995 7:47363439-47363461 CAGGATGCACAGAAGTCCCCCGG + Intronic
1024358031 7:48437769-48437791 CAGGCTGATCTCAAGACCCAGGG - Intronic
1029000357 7:97147957-97147979 CAGGCTGCAGTGCAGGCTCACGG + Intronic
1029506321 7:100965956-100965978 GAGGCTCCACTGTAGGCCCAGGG - Intronic
1030278212 7:107743038-107743060 GAGACTGCACTGAAGGTCCTAGG + Intergenic
1032120997 7:129156418-129156440 CAGTCTGCACTGAAGGAGTAAGG + Intronic
1032153589 7:129450753-129450775 TAGGCTGCAGAGAAGGCCCTTGG - Intronic
1032466624 7:132150012-132150034 CAGGCAGCAGGGAAGCCCCAGGG - Intronic
1034420864 7:150989920-150989942 CAGCCAGCACTGAAGGCTGAGGG - Intergenic
1034469708 7:151248712-151248734 AGGGCTGCCCTGACGGCCCACGG + Exonic
1035754011 8:2017713-2017735 CAGTGTTCACTCAAGGCCCAGGG + Intergenic
1036078455 8:5526428-5526450 CAGACAGCACTGAGGGGCCAGGG + Intergenic
1037494261 8:19423879-19423901 CAGGCTGCACAGAAAGCCCTGGG + Intronic
1038182210 8:25239995-25240017 CAGGGTGCACTGCAGGCCCAGGG + Intronic
1039972367 8:42331121-42331143 CCTGCTGCACTGATGGCCCAGGG + Exonic
1045856809 8:106773694-106773716 CAGGCTGAAGTGAAGTGCCATGG + Intergenic
1046155760 8:110288075-110288097 CAAGCTGTGCTGCAGGCCCAAGG - Intergenic
1048527271 8:135214540-135214562 CAGGCACCTCTGAAGGCCCTGGG - Intergenic
1048849843 8:138634500-138634522 CAGCCTACACTGAAGGCAGAGGG + Intronic
1049106049 8:140613803-140613825 CAGGCTGGTCTCAAGCCCCAGGG - Intronic
1056069207 9:82968442-82968464 CAGGCTTCCCTGAAGGCTCCAGG + Intergenic
1058855576 9:109058650-109058672 CAGGCTGCACTGGAGTGCAATGG + Intronic
1060166608 9:121422552-121422574 CAGTGTTCACTCAAGGCCCAAGG + Intergenic
1061941561 9:133886908-133886930 CAAGATGCACAGGAGGCCCAGGG + Intronic
1061995507 9:134180906-134180928 CAGGAGGCAGTGGAGGCCCAAGG - Intergenic
1062011410 9:134268928-134268950 GAGGCTGCAGTGAGGACCCAGGG + Intergenic
1062031038 9:134362122-134362144 CAACCCGCACAGAAGGCCCAGGG - Intronic
1062120156 9:134829815-134829837 CAGGCTGCACTGAAGGCGCTCGG + Intronic
1062339141 9:136086196-136086218 TTTGCTGCTCTGAAGGCCCATGG - Intronic
1062373868 9:136253404-136253426 GGGGCTGCACTGATGGCCCTGGG + Intergenic
1062625105 9:137438942-137438964 CAGCCTGCACTGGGGGCCCAGGG + Intronic
1191062211 X:56310645-56310667 GAAGCTGCACTGCTGGCCCAAGG + Intergenic
1191834130 X:65445979-65446001 CAGGTTTCACCCAAGGCCCATGG + Intronic
1192045965 X:67674617-67674639 CAATCTTCACTCAAGGCCCAGGG + Intronic
1192304391 X:69943992-69944014 CAGTGTTCACTCAAGGCCCAAGG + Intronic
1192374911 X:70549595-70549617 CAGTGTTCACTTAAGGCCCAAGG - Intronic
1193425441 X:81336805-81336827 GAGGCTGCATTGTAGGCCCAAGG + Intergenic
1193912989 X:87328043-87328065 CTGGCTGCATTGTGGGCCCAAGG - Intergenic
1194626655 X:96233443-96233465 CAGACTGCACCTATGGCCCATGG + Intergenic
1195877491 X:109557367-109557389 CAGGCTGCCCTGGAAGACCATGG - Intergenic
1199086687 X:143635976-143635998 CATTCTGCACCAAAGGCCCACGG - Intergenic
1199671944 X:150155010-150155032 CAGGATGCACAGAAGGACCAGGG - Intergenic
1199964426 X:152807731-152807753 GACGCTGCACTGCAGGCCCTGGG - Intergenic
1199990121 X:152982848-152982870 GAGTCTGCCCTGCAGGCCCAGGG + Intergenic
1202046189 Y:20738979-20739001 CAGGCTGCTGTGAAATCCCATGG - Intergenic