ID: 1006391118

View in Genome Browser
Species Human (GRCh38)
Location 6:33759400-33759422
Sequence GTGTATACAAAAAATTAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006391118_1006391120 0 Left 1006391118 6:33759400-33759422 CCTGGCTAATTTTTTGTATACAC No data
Right 1006391120 6:33759423-33759445 AGGTTTTTGCCATGTTGACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006391118 Original CRISPR GTGTATACAAAAAATTAGCC AGG (reversed) Intergenic
No off target data available for this crispr