ID: 1006391826

View in Genome Browser
Species Human (GRCh38)
Location 6:33763145-33763167
Sequence TGAGGTCCTCACTCAGAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006391818_1006391826 3 Left 1006391818 6:33763119-33763141 CCTACTGCTCCCCTCTCCTCCAG No data
Right 1006391826 6:33763145-33763167 TGAGGTCCTCACTCAGAGCCTGG No data
1006391820_1006391826 -6 Left 1006391820 6:33763128-33763150 CCCCTCTCCTCCAGACCTGAGGT No data
Right 1006391826 6:33763145-33763167 TGAGGTCCTCACTCAGAGCCTGG No data
1006391822_1006391826 -8 Left 1006391822 6:33763130-33763152 CCTCTCCTCCAGACCTGAGGTCC No data
Right 1006391826 6:33763145-33763167 TGAGGTCCTCACTCAGAGCCTGG No data
1006391821_1006391826 -7 Left 1006391821 6:33763129-33763151 CCCTCTCCTCCAGACCTGAGGTC No data
Right 1006391826 6:33763145-33763167 TGAGGTCCTCACTCAGAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006391826 Original CRISPR TGAGGTCCTCACTCAGAGCC TGG Intergenic
No off target data available for this crispr