ID: 1006393652

View in Genome Browser
Species Human (GRCh38)
Location 6:33773282-33773304
Sequence ACAACGGAGGGCCCCTTCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006393644_1006393652 12 Left 1006393644 6:33773247-33773269 CCAAGAAGCTGGAGCTGCTCTAG 0: 1
1: 0
2: 2
3: 24
4: 248
Right 1006393652 6:33773282-33773304 ACAACGGAGGGCCCCTTCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006393652 Original CRISPR ACAACGGAGGGCCCCTTCAG TGG Intronic
No off target data available for this crispr