ID: 1006394114

View in Genome Browser
Species Human (GRCh38)
Location 6:33775967-33775989
Sequence AACCAGAGCCAACACTGGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 166}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006394102_1006394114 15 Left 1006394102 6:33775929-33775951 CCAGAAACCACAGCAAGTGTCTG 0: 1
1: 0
2: 1
3: 23
4: 207
Right 1006394114 6:33775967-33775989 AACCAGAGCCAACACTGGGGGGG 0: 1
1: 0
2: 1
3: 11
4: 166
1006394105_1006394114 8 Left 1006394105 6:33775936-33775958 CCACAGCAAGTGTCTGCTAGGGA 0: 1
1: 0
2: 0
3: 15
4: 106
Right 1006394114 6:33775967-33775989 AACCAGAGCCAACACTGGGGGGG 0: 1
1: 0
2: 1
3: 11
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006394114 Original CRISPR AACCAGAGCCAACACTGGGG GGG Intronic
901748975 1:11394211-11394233 AACCAGAGCCAAAAAAGTGGAGG - Intergenic
902705735 1:18202947-18202969 ACCCAAAGCCAAGACTGGGATGG - Intronic
904489935 1:30852332-30852354 ATCCAGAGCCAGCCCTGGGCAGG + Intergenic
906705871 1:47894988-47895010 AAGCTGAGCCAGGACTGGGGTGG - Intronic
912090097 1:106061933-106061955 AACAAAAGCAAACCCTGGGGAGG - Intergenic
913155539 1:116093274-116093296 AACCAGTTCCAGCACTGGGCAGG + Intergenic
913326798 1:117634843-117634865 AACCACAACCAACCCTGAGGAGG - Intergenic
915780705 1:158547051-158547073 AACCAAAGACAAGACTGAGGGGG + Intergenic
915914115 1:159931014-159931036 AAGCAGAGCCAGGACTGGTGAGG + Intronic
918449729 1:184646902-184646924 ACTCAGAGCCAACACTGAGTGGG - Intergenic
919754488 1:201058372-201058394 AGGCAGAGCCATCACTAGGGTGG - Intronic
919822611 1:201482462-201482484 AGCCAGAGCCCACCCTGGGCTGG + Intergenic
921964251 1:221071105-221071127 AACCAGGGCCCACACAAGGGAGG - Intergenic
922169832 1:223144648-223144670 AACCAGATGCCACCCTGGGGAGG - Intergenic
922181718 1:223241129-223241151 AACCACAGCCAAAACTGCTGGGG - Intronic
1063271109 10:4510598-4510620 AACCAGAGCCACTGCTGGGAAGG - Intergenic
1063374545 10:5546244-5546266 AGCCAGAGCCATCACAGGGCGGG + Intergenic
1068544427 10:58329834-58329856 ATGCAGAGCCAATACTAGGGTGG + Intergenic
1074445932 10:113520855-113520877 AGCCAGAGACATCACTGGAGCGG - Intergenic
1075087644 10:119424152-119424174 AATCAGATCCAACAGTGGGTGGG + Intronic
1075199776 10:120392975-120392997 AACTAGTGCCAACCATGGGGAGG + Intergenic
1075261654 10:120968521-120968543 AACCTGGGTCACCACTGGGGAGG - Intergenic
1076570264 10:131428103-131428125 GGCCAAAGCCAACATTGGGGTGG - Intergenic
1076996649 11:300285-300307 AGCCAGAGACAAGACTGGGGCGG - Intergenic
1077360830 11:2139525-2139547 AACCCGAGCCAAGAGCGGGGCGG + Intronic
1077914745 11:6603883-6603905 GAACGGAGCCAACCCTGGGGAGG + Exonic
1082068140 11:47917339-47917361 AACCAAGGCCCAAACTGGGGAGG - Intergenic
1082797459 11:57388434-57388456 ACCCACAGACAACACTGAGGGGG - Intronic
1082941642 11:58711304-58711326 AACCAGACACAACAGTAGGGTGG + Intronic
1083886678 11:65576514-65576536 AACCAGGGCCCAAGCTGGGGTGG - Intronic
1084649698 11:70481967-70481989 AGTCAGAACCACCACTGGGGGGG - Intronic
1085847750 11:80085220-80085242 AATCAGGGACAACACTGGGATGG - Intergenic
1087038140 11:93774048-93774070 ACCCAGAGCCATCAGCGGGGTGG + Intronic
1087682309 11:101231415-101231437 CACAAGAGCCCACAGTGGGGAGG + Intergenic
1089581855 11:119486380-119486402 AATCAAAGCCAAGACTGGTGGGG - Intergenic
1091227438 11:133966094-133966116 ATCCAGAGCCCTGACTGGGGAGG + Intergenic
1093976686 12:25430785-25430807 AACCAGAGCCAACAGAAGGTGGG - Intronic
1103051455 12:117783502-117783524 GGCCAGAGCCAAAACTGGGATGG - Intronic
1105023457 12:132833439-132833461 AGGCAGAGGCAACCCTGGGGAGG + Intronic
1107853319 13:44591638-44591660 ATCCACAGCCAAGACTTGGGAGG - Intergenic
1108331630 13:49390561-49390583 AAATAGAGCAAACCCTGGGGGGG + Intronic
1110279311 13:73674273-73674295 AACAAGAGCCAACATTTTGGAGG - Intergenic
1111304311 13:86386047-86386069 AATCATAGCCAACAGAGGGGTGG + Intergenic
1112781340 13:102904229-102904251 AAGCAGAGAGGACACTGGGGTGG + Intergenic
1113101205 13:106721568-106721590 AACAAGAACAAACCCTGGGGTGG - Intergenic
1113657844 13:112080011-112080033 AACCAGAGGCAAGGCTGGAGAGG + Intergenic
1118284040 14:64454830-64454852 AACCAGCCCCAACGCTGGCGCGG - Exonic
1122878987 14:104681626-104681648 AAGCAGAGCAGACACGGGGGCGG + Intergenic
1123068388 14:105629346-105629368 AAGCGGAGCCAGCACGGGGGAGG - Intergenic
1123072399 14:105648151-105648173 AAGCGGAGCCAGCACGGGGGAGG - Intergenic
1123092408 14:105747670-105747692 AAGCGGAGCCAGCACGGGGGAGG - Intergenic
1123097985 14:105775371-105775393 AAGCGGAGCCAGCACAGGGGAGG - Intergenic
1123866656 15:24526112-24526134 AACCAGACACAGCAGTGGGGTGG + Intergenic
1124176891 15:27434768-27434790 AACCAAAGCCACCAGAGGGGAGG - Intronic
1128840961 15:70851809-70851831 AAACACAGCCAGCTCTGGGGTGG + Intronic
1131355579 15:91742939-91742961 AGCCAGGGCCAAGGCTGGGGAGG - Intergenic
1131418057 15:92278016-92278038 AGCCTGAGCAAGCACTGGGGTGG - Intergenic
1132896118 16:2230151-2230173 CACCAGAGGGAGCACTGGGGAGG - Intronic
1132976167 16:2712170-2712192 CCCCAGTGCCAACCCTGGGGCGG + Intergenic
1134380052 16:13715840-13715862 AAGCAGAGCAAACTCTGGAGTGG + Intergenic
1135565055 16:23505645-23505667 ACCCAGAGCCAAAGGTGGGGAGG - Intronic
1137630548 16:49940644-49940666 AACCACAGCAAGCACAGGGGAGG + Intergenic
1137884364 16:52086689-52086711 AAACAGCGCGAACACTAGGGGGG + Intergenic
1139960967 16:70717055-70717077 AGGCAGAGCCAACAATGGTGTGG - Intronic
1142661963 17:1436794-1436816 AATCAGAGCCGATACTGAGGCGG + Exonic
1142912358 17:3105189-3105211 AGCAAGAACCAACACAGGGGAGG + Intergenic
1143504474 17:7356163-7356185 CAGCAGAGGCAACGCTGGGGAGG - Exonic
1144452519 17:15392809-15392831 AACCAAACCCAACACTGGTGTGG + Intergenic
1145002196 17:19313213-19313235 AACCAGACCAACCCCTGGGGCGG + Exonic
1145867075 17:28248216-28248238 GGCCAGAGCCAACAGTGTGGAGG - Intergenic
1147385524 17:40079132-40079154 AGCGAGAGCCAGTACTGGGGGGG + Intronic
1147558494 17:41494918-41494940 GACCAGGACCAACACTGTGGAGG - Intergenic
1149071917 17:52553782-52553804 AAATAGAGCCAACCCTGGAGAGG + Intergenic
1153488407 18:5625299-5625321 AGCCAGAGCCAGGACTGGTGGGG + Intronic
1153942614 18:9990916-9990938 AACCAGCGCCCAGACCGGGGCGG + Intergenic
1155094855 18:22545658-22545680 AAGAATAGCCAAAACTGGGGTGG + Intergenic
1155384267 18:25259967-25259989 TACCAGAGCAAACAAGGGGGAGG + Intronic
1156199663 18:34815957-34815979 AACCAGACCAGACACTGCGGGGG - Exonic
1157122833 18:44927652-44927674 AACCAGAGCCAGGTCTGGGCTGG + Intronic
1158441651 18:57479971-57479993 AACCACAGCTGGCACTGGGGTGG + Exonic
1160819389 19:1050942-1050964 AGGCAGAGCCACCACTGGGTGGG - Exonic
1167066431 19:47189584-47189606 AAAGTGAGCCAACCCTGGGGAGG + Intronic
1168323123 19:55521972-55521994 AGCCAGGGCCAGCACTGGGCGGG - Intergenic
1168721364 19:58556572-58556594 AACCACAGACAACAAAGGGGTGG + Intronic
926157863 2:10467625-10467647 AACCAGAAGGAACACTGGGCGGG + Intergenic
930089818 2:47523640-47523662 GACCACAGCCAGCACTGGGCAGG - Intronic
930968280 2:57359494-57359516 CACCAGAGCCTACACTGGGGTGG - Intergenic
931289686 2:60861668-60861690 AGCCAGAGCCAAAACTGGCCAGG - Intergenic
931496498 2:62813191-62813213 AACCACAGCCATGGCTGGGGTGG - Intronic
932574141 2:72953654-72953676 CACCAGAGCCTACACAGGTGAGG + Intronic
934528476 2:95068536-95068558 GACCACAGCCACCTCTGGGGAGG - Intergenic
934616799 2:95776368-95776390 GACCAGAGCCACCATTGTGGAGG - Intergenic
934644092 2:96048192-96048214 GACCAGAGCCACCATTGTGGAGG + Intergenic
934764749 2:96874396-96874418 GACAAGAGCCAGGACTGGGGAGG + Intergenic
934837508 2:97604285-97604307 GACCAGAGCCACCATTGTGGAGG + Intergenic
936622386 2:114113796-114113818 AACCAAAGCCATCACTGAGGGGG + Intergenic
938184291 2:129214772-129214794 ATTCAGAGACAACACTGTGGAGG + Intergenic
945916178 2:215706313-215706335 AAACAGAGCCAACACAGGATGGG + Intergenic
946256301 2:218444703-218444725 AGCCAGTGACAACAGTGGGGTGG + Intronic
946341983 2:219075888-219075910 ATCCAGAGACAACAATGGGGTGG + Exonic
947269300 2:228316192-228316214 AATCAGAGCCAACACTTGAAAGG - Intergenic
947912551 2:233811026-233811048 AAGCAGAGCCAAGACAGGGAAGG - Intronic
948403478 2:237701205-237701227 AAACACAACCAACACTGGTGGGG - Intronic
948734223 2:239989430-239989452 AACCACAGCCACCACTGCCGCGG + Intronic
949012216 2:241687165-241687187 AACGAGAGCCGACGCTGGGCGGG - Intergenic
1170484718 20:16804839-16804861 AACCAGAGCCAAGACTGATGAGG - Intergenic
1171241380 20:23569783-23569805 TGCCTGACCCAACACTGGGGTGG + Intergenic
1173666516 20:44767028-44767050 AACCAGAGCCAATCCTGATGGGG - Intronic
1174198662 20:48791583-48791605 AACCTGACCCATCACTGGGACGG - Intronic
1175575578 20:60058244-60058266 CACCAGAGCAAACCCTGGGAGGG + Intronic
1177570453 21:22879153-22879175 AACCAGTGCCAACACTGCTGTGG - Intergenic
1178759596 21:35389006-35389028 AAGCAGAACCAACACTGGGCGGG - Intronic
1179287783 21:39992926-39992948 AACAAGAGCCATTCCTGGGGAGG - Intergenic
1179651571 21:42812761-42812783 AACCAGACACAACAGTAGGGTGG + Intergenic
1180568743 22:16697090-16697112 CAACAGGACCAACACTGGGGTGG - Intergenic
1181465701 22:23109527-23109549 ACCCAGGGCCTACACTTGGGAGG + Intronic
1184420715 22:44381428-44381450 AACCAGAGCCATCCCTGGGAGGG + Intergenic
1184510424 22:44930150-44930172 AGGCAAAGCCAGCACTGGGGCGG + Intronic
1184740726 22:46427627-46427649 AACCATTGCCAACAGTGCGGTGG - Intronic
950659248 3:14456615-14456637 AACCAGAGCCCTGACTGTGGGGG + Intronic
954474060 3:50726765-50726787 AACAACAGCAAACTCTGGGGAGG + Intronic
954981388 3:54748740-54748762 AAGCAGAGCCAAATCTGGGGTGG - Intronic
959977106 3:112473213-112473235 AACCAGAGCTAGCCTTGGGGAGG + Intronic
961467908 3:127092604-127092626 AACCAGAGCCCAAACTAAGGCGG - Intergenic
961612276 3:128149753-128149775 AACCAGAGCCCACACAAGGAGGG + Intronic
963606479 3:147415927-147415949 TACCACATCAAACACTGGGGAGG + Exonic
966676725 3:182598023-182598045 GACCAGAGCCAACCCTTTGGAGG - Intergenic
969107505 4:4818795-4818817 AAACAGAGCCAACACTTTGAGGG - Intergenic
974715651 4:65667675-65667697 AACAAGAGCCAAGACTGTGCAGG - Intronic
975907874 4:79236776-79236798 AAACAGAGCCATCTCTGAGGTGG + Intronic
981054373 4:140345089-140345111 AACCAGTGCCAACAGTGGACTGG - Intronic
981924011 4:150117713-150117735 AACCAGCTCCAGCACTGGGTAGG + Intronic
982171818 4:152669309-152669331 AACCAGAACCAACACAGAGATGG + Intronic
984286693 4:177738875-177738897 TACCAGTTCCAGCACTGGGGAGG + Intronic
986707453 5:10463588-10463610 AACCATAACCAGCACTTGGGGGG - Intronic
990242139 5:53826449-53826471 AACCAGGGCTGACTCTGGGGTGG + Intergenic
991614282 5:68479871-68479893 GTCAAGAGCCAACACAGGGGAGG + Intergenic
997773778 5:136579351-136579373 AAGAAAAGACAACACTGGGGAGG + Intergenic
1002165911 5:177345670-177345692 AGCCAGAGCAAACAGTGGTGAGG - Intronic
1002270774 5:178070617-178070639 AACCAGACCCTCCACTGTGGAGG - Intergenic
1002586187 5:180250130-180250152 ACACAGAGTCAGCACTGGGGAGG - Intronic
1002782386 6:377356-377378 CCCCAAAGCCCACACTGGGGAGG + Intergenic
1003888932 6:10546269-10546291 GACCAGTGCCAACAATGTGGCGG + Intronic
1004347428 6:14861704-14861726 AACCAGAGCAGCCACTGGGGAGG + Intergenic
1006394114 6:33775967-33775989 AACCAGAGCCAACACTGGGGGGG + Intronic
1006593954 6:35179226-35179248 AAACAAACCCAACACTGTGGGGG + Intergenic
1012088500 6:94860108-94860130 TACCAGAGCGGACACTGGGAAGG - Intergenic
1012873635 6:104700040-104700062 AACCATACACAACACTGGTGAGG + Intergenic
1013165081 6:107582831-107582853 ATCTAGAGCCGACAGTGGGGTGG + Intronic
1014422278 6:121260836-121260858 AGGCAGAGCCAACACTGCTGCGG + Intronic
1014709511 6:124790041-124790063 CAGCAGTGCCCACACTGGGGAGG - Intronic
1019972610 7:4553596-4553618 AACCAGAGCTGACATTTGGGTGG - Intergenic
1022531557 7:31070052-31070074 GGCCAGAGCCAGCTCTGGGGTGG + Intronic
1024258567 7:47557722-47557744 AACCATCACCACCACTGGGGTGG + Intronic
1024629475 7:51235474-51235496 AACCAGATACAAAACTGTGGTGG + Intronic
1026339652 7:69424358-69424380 AACCGTAGACAACACTTGGGTGG - Intergenic
1029104732 7:98165897-98165919 GACCAGAGCCAGCAGAGGGGAGG + Intronic
1030818950 7:114073269-114073291 ACCCAAAGCCAATACTGAGGAGG + Intronic
1032074811 7:128831315-128831337 AACCCTAGCCCACACTCGGGAGG + Intronic
1032098672 7:128954550-128954572 GAGAAGAGCCAAAACTGGGGTGG - Exonic
1036189966 8:6661475-6661497 AACCTCAGCCAACGCTGAGGAGG + Intergenic
1041411273 8:57559157-57559179 CACCAGAGCCCACACAGGGCTGG - Intergenic
1044213578 8:89580597-89580619 AAGCAGAGCCAGCAATGGTGGGG + Intergenic
1044575943 8:93769141-93769163 TAGCAGAACCAACACTGGCGCGG + Intronic
1047051357 8:121116967-121116989 CACCAGAACCACAACTGGGGTGG - Intergenic
1047329733 8:123875902-123875924 GACCAGAGCCAACAGTGGCTTGG - Intronic
1049009798 8:139879648-139879670 CAGCAGGGCCAACACAGGGGAGG - Intronic
1049065113 8:140307249-140307271 AACTAAAGCCAACACTGCAGCGG + Intronic
1051215501 9:14793514-14793536 TACCAGAGCCACCACTGCTGTGG + Intronic
1052090734 9:24323785-24323807 AAACAGAACCAAAGCTGGGGGGG - Intergenic
1053415477 9:37944553-37944575 CAGCAGAGCCAAGACTGGAGTGG - Intronic
1057339631 9:94188318-94188340 AACAACAGCAAACACTGGGGAGG - Intergenic
1058577521 9:106419924-106419946 AACCAGAGCTCACACAGAGGCGG - Intergenic
1061721955 9:132557348-132557370 AACCAGAGCCACCGCCGTGGGGG + Intronic
1189366957 X:40396200-40396222 AACCAGACCCAGCACTGGTCAGG + Intergenic
1189601371 X:42630248-42630270 AACCAGGGCCCAAACTGGAGGGG - Intergenic
1191872074 X:65755680-65755702 GACAAGAACAAACACTGGGGAGG - Intergenic
1194193550 X:90865525-90865547 GAGCAGAGCCAGCAATGGGGAGG - Intergenic
1197755869 X:129994242-129994264 ACCCATAGCCTACACTGCGGTGG - Intronic