ID: 1006395088

View in Genome Browser
Species Human (GRCh38)
Location 6:33782051-33782073
Sequence CTGTGTTAGGGGAAGGCGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 131}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006395088_1006395098 17 Left 1006395088 6:33782051-33782073 CCTGTCGCCTTCCCCTAACACAG 0: 1
1: 0
2: 0
3: 6
4: 131
Right 1006395098 6:33782091-33782113 AAAGTTGATCTTGACCCCAGGGG 0: 1
1: 0
2: 2
3: 5
4: 109
1006395088_1006395097 16 Left 1006395088 6:33782051-33782073 CCTGTCGCCTTCCCCTAACACAG 0: 1
1: 0
2: 0
3: 6
4: 131
Right 1006395097 6:33782090-33782112 CAAAGTTGATCTTGACCCCAGGG 0: 1
1: 0
2: 0
3: 9
4: 150
1006395088_1006395096 15 Left 1006395088 6:33782051-33782073 CCTGTCGCCTTCCCCTAACACAG 0: 1
1: 0
2: 0
3: 6
4: 131
Right 1006395096 6:33782089-33782111 TCAAAGTTGATCTTGACCCCAGG 0: 1
1: 0
2: 0
3: 6
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006395088 Original CRISPR CTGTGTTAGGGGAAGGCGAC AGG (reversed) Intronic
902060597 1:13638888-13638910 ATGTGTTATGGGAAGGCTAATGG + Intergenic
902682317 1:18052077-18052099 GTGTGTTAGGGGAAGGAGTAGGG - Intergenic
902973512 1:20072148-20072170 GTGTGTTTGGGGATGGGGACGGG - Intronic
903572650 1:24317934-24317956 CTGTGTTGGGGGAAGCCCAGGGG - Intergenic
904475447 1:30762057-30762079 CTGGGTTCGGGGCAGGAGACAGG - Intergenic
911057378 1:93720535-93720557 CTGTGGTCTGGGAAGGCGAGTGG - Intronic
914732830 1:150387366-150387388 GTGTGTTAGGGAAAGGAGAGAGG + Intronic
914847730 1:151292193-151292215 CTGGGTTTGGGGAAGGAGTCAGG + Exonic
916124977 1:161561420-161561442 ATGTGTTATGGGAAGGATACTGG + Intergenic
916134871 1:161642765-161642787 ATGTGTTATGGGAAGGATACTGG + Intronic
916801827 1:168223102-168223124 GTGTGTTAGGGGAAGGGAAAGGG + Intergenic
919369789 1:196708702-196708724 CTCTGTTAGGGCAAGCCCACTGG + Intronic
920045816 1:203131673-203131695 CTGAGTTAGGGAAAGGCTGCTGG + Intronic
920964810 1:210692962-210692984 CTCCGTTAGGGGAGGGAGACAGG - Intronic
1070312606 10:75284423-75284445 CTGGGTTGGGGGAAGGGGACTGG + Intergenic
1070741583 10:78907048-78907070 CTGTGTGGAGGGAAGGGGACAGG - Intergenic
1071229918 10:83573605-83573627 CTGTGTGATGGGAAGGCACCTGG - Intergenic
1075677746 10:124307998-124308020 CTGTGTCTGGGGAAGGTGTCAGG + Intergenic
1077491947 11:2865041-2865063 ATGTGTTAGGGAAAGGCCCCAGG - Intergenic
1081654415 11:44848157-44848179 CTGTGTTAGGGAAGGCTGACAGG + Intronic
1083048011 11:59754066-59754088 ATGTGTTAGGGGAAGGAGGTGGG + Intronic
1091057389 11:132431517-132431539 CTCTGTGTGGGGAAGGCAACCGG + Intronic
1092146276 12:6216795-6216817 CTGTGATCGGAGAAGGCGGCTGG - Intronic
1093233377 12:16576174-16576196 CTGTGTTATAGAAAGGCTACCGG - Intronic
1095958297 12:47819044-47819066 CTGTGTGAGGGGTGGGGGACAGG - Intronic
1097578455 12:61424009-61424031 CTGTTTTACCGGAAGTCGACTGG - Intergenic
1100239274 12:92694553-92694575 CTGTGTTGGGGGAAGGGAAAAGG + Intergenic
1101857941 12:108459577-108459599 CTGTTTTCTGGGAAGGGGACTGG - Intergenic
1106020448 13:25909796-25909818 CTGAGTTGGGGGAGGGCGGCGGG - Intronic
1110479660 13:75959542-75959564 CTGAGTCAGGGGAAGGAGGCTGG + Intergenic
1115508881 14:34120343-34120365 CTGAGTTAGGGCAAGGGGGCTGG - Intronic
1119826803 14:77663539-77663561 CTGTGTTAGGTGAATGTAACAGG - Intergenic
1120818070 14:88883883-88883905 CTGTTTTAAGGGAAGGGGCCGGG - Intergenic
1122203296 14:100135684-100135706 CTGGGGAAGGGGAAGGCTACAGG - Intronic
1128250895 15:66163707-66163729 CTGAGTTATGGGAAGGCGGGCGG + Intronic
1131450179 15:92532860-92532882 CTGGTTTAGGGGTAGGCAACAGG - Intergenic
1132556006 16:572976-572998 CTGTGTCTGAGGAAGGCGAGCGG + Intronic
1142523023 17:518370-518392 CTGTGTTATGAGAAGGAGTCTGG - Exonic
1145957046 17:28861774-28861796 GTGGGTTATGGGAAGGGGACTGG + Intergenic
1151917868 17:77132010-77132032 CTGTGTTAGCTCAAGGCCACTGG + Intronic
1153405395 18:4733054-4733076 CAGTCTTAGGGGAAGGAGAAGGG - Intergenic
1153946647 18:10023823-10023845 CTGTGAGAGGGGAGGGCCACTGG + Intergenic
1158495904 18:57954931-57954953 CTGAGTTGGGGCAAGGGGACAGG + Intergenic
1160495973 18:79375635-79375657 CTGAGTGAGGGGAAGGGGCCGGG + Intronic
1160928816 19:1560133-1560155 CTGTGAAAGGGGAAGGTAACAGG + Intronic
1161209248 19:3057632-3057654 CAGTGTTGGGGGCGGGCGACAGG - Intronic
1165302498 19:34979615-34979637 CAGTGATAGGGGAATGCAACTGG - Intergenic
1165312487 19:35037249-35037271 CTGTGTTAGGAGAAGGCAGATGG + Intronic
1166367716 19:42285742-42285764 CAGTGTGAGGGGAAGCCCACTGG + Intronic
928948837 2:36796481-36796503 ATGTGGTAGGGGAAAGAGACAGG + Intronic
931486645 2:62700425-62700447 CTATGTTGGGGGAAGGGGATGGG + Intronic
932215850 2:69965573-69965595 CTGTGTTCTGGGAAGTCGTCAGG - Intergenic
934555098 2:95282918-95282940 CTGTGTTTGGGGAGGGCGAGGGG - Intronic
935361802 2:102251540-102251562 CTGTCTTAAGGGAAGGTGCCTGG - Intergenic
936088572 2:109486716-109486738 ATGTGTTAGAGGAAGGGGAGGGG + Intronic
937584328 2:123527423-123527445 CTGTGGAAGGGGAAGGGGAATGG + Intergenic
945080084 2:206079762-206079784 CTGTGTTAGGGGAAGGAGTTTGG - Intronic
946534858 2:220615924-220615946 CTGTATGAGGGGAATGAGACTGG - Intergenic
947454511 2:230241593-230241615 CTGTGTGAGGGGAGGAGGACTGG - Intronic
947538197 2:230954221-230954243 CTGTGTCAGGGGAAGGGGCAAGG - Intronic
948751348 2:240135203-240135225 CTGGGTTGGGGGATGCCGACTGG - Intronic
948797418 2:240412080-240412102 CTGTGTGCGGGGAAGGAGAACGG - Intergenic
1169072145 20:2739192-2739214 CTGGGTGATGGGAAGGCTACAGG - Intronic
1170204541 20:13784520-13784542 CCGAGAGAGGGGAAGGCGACCGG + Intronic
1172638211 20:36424160-36424182 CTGTGACAGGTGAAGGGGACAGG + Intronic
1172930914 20:38585967-38585989 CTGGGTCAGGGGTAGGAGACAGG + Intronic
1173556512 20:43969924-43969946 GTGTGTTAGGGGCAGGCAAGGGG - Intronic
1175641686 20:60635590-60635612 CTGTGTTAAGAGAAGGATACTGG - Intergenic
1180394181 22:12314402-12314424 GTGGGTTAGGGGAAGGGGGCAGG - Intergenic
1180405565 22:12550347-12550369 GTGGGTTAGGGGAAGGGGGCAGG + Intergenic
1180411743 22:12617976-12617998 CTGTGTTTTGGGAAGGCAATGGG - Intergenic
1181690612 22:24557308-24557330 GTGTGTCAGGGGAGGGGGACTGG - Intronic
1181987064 22:26807136-26807158 CTGTGCTTCGGGAAGGCGCCAGG - Intergenic
1183401564 22:37608092-37608114 GTGTGATAGGGGAAGCCCACGGG - Intergenic
950161434 3:10764038-10764060 GTGAGTGAGGGGAAGGCAACAGG - Intergenic
952591065 3:34954253-34954275 CTGTGTATGGGGAAGGAGATAGG + Intergenic
957961292 3:87256921-87256943 CAGTGTTTGGGGATGGCGGCGGG - Intergenic
961475239 3:127141855-127141877 CTGTGTTAGGGGAGGAGGCCTGG - Intergenic
964540618 3:157775250-157775272 CTCTGATAGGGAAAGGCAACAGG + Intergenic
968075957 3:195816262-195816284 CTGTGTAAGGAGAAGGAGGCCGG - Intergenic
968076144 3:195816953-195816975 CTGTGTAAGGAGAAGGAGGCCGG - Intergenic
970392633 4:15631064-15631086 CTGTGGTGGGGGTAGGGGACTGG - Intronic
973362873 4:49181324-49181346 GTGTGTCAGGGGCAGACGACAGG - Intergenic
973554383 4:52067478-52067500 CTGGGTCAGGGGAAAGTGACAGG - Intronic
975613162 4:76221154-76221176 TTGTGGCAGGGGAAGGGGACAGG + Intronic
980420692 4:132556322-132556344 CTGTGTGAGGGGAAAGTGCCAGG + Intergenic
980524818 4:133976105-133976127 CTCTGTTGGGGGAAGGTGGCAGG - Intergenic
981276223 4:142900894-142900916 CTGTGGTTGGGGGAGGCCACAGG + Intergenic
984637979 4:182134416-182134438 CTGAGTTAGGGGAAAGAGAAGGG - Intergenic
985708459 5:1414895-1414917 CTGTGTCTGGGGAAGGGGGCGGG + Intronic
985803584 5:2021999-2022021 CTGTGTTAGGGGGAGGCAAGGGG - Intergenic
989662740 5:43816649-43816671 CAGTGTTAGAGGAAGGGGTCTGG + Intergenic
992499488 5:77327860-77327882 CTGTGTGGGGGGAAGGCTCCCGG - Intronic
992610659 5:78505453-78505475 GTGTGTCAGGGGAAGGGGAGGGG + Intronic
993050973 5:82925500-82925522 GTGTGTTAGGGGAAGTTGTCAGG + Intergenic
994335720 5:98563477-98563499 CTGTGTTTGGGGATGGAGAAAGG - Intergenic
994675321 5:102814023-102814045 CTGTGGTAGGGGCAGGAGACTGG + Intronic
998459305 5:142297620-142297642 CTGTGTCAGGGGTTGGCGAGGGG + Intergenic
1000883909 5:166728752-166728774 GTGTGTTGGGGGAATGCTACTGG + Intergenic
1001024273 5:168210288-168210310 CTATGTTGGGGGAAGGAGAAGGG - Intronic
1001210781 5:169808312-169808334 GTGTGTTTGGGGAATGGGACAGG + Intronic
1002514468 5:179746962-179746984 CTGTTTCAGGGGTAGGCGGCTGG - Intronic
1002575378 5:180171106-180171128 CTGGGCTGGGGGAAGGCCACAGG - Intronic
1006030179 6:31172117-31172139 CTGTGTGAGGGGATTGGGACTGG - Intronic
1006395088 6:33782051-33782073 CTGTGTTAGGGGAAGGCGACAGG - Intronic
1006435859 6:34025956-34025978 CAGTGTGAGGGGAAGGCCAAGGG + Intronic
1006787329 6:36677320-36677342 CTGCGTTAGAGGAAGAAGACTGG + Intronic
1013273673 6:108562887-108562909 CTGTCTTGGGGGAAGGGGCCAGG - Intronic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1017616765 6:156254295-156254317 CTGTGTCAGGGGCAGGCTGCAGG - Intergenic
1018468789 6:164078707-164078729 CTGTCTCAGGGGAAGGCTGCTGG + Intergenic
1020267059 7:6567929-6567951 GTGTGTGGGGGGAAGGTGACGGG + Intergenic
1021121223 7:16797950-16797972 CTGTGTTTGGGGAAGACATCTGG + Intronic
1023088503 7:36596175-36596197 ATCTCTTAGGGGAAGGTGACGGG - Intronic
1032007559 7:128315226-128315248 CTGTGTTATGGGAAGGGGAATGG - Intronic
1034482404 7:151332611-151332633 CAGTCTTGGGGGAAGGCAACAGG + Intergenic
1038922138 8:32096588-32096610 CTGTATTTGGTGAAGGCCACAGG + Intronic
1041114001 8:54516691-54516713 CTGTGGGAGGGTAAGGCGAGAGG + Intergenic
1042835048 8:73072108-73072130 CTGTGTGAGAGGAAGGAGAGGGG + Intronic
1043850135 8:85206448-85206470 GTGTGGAAGGGGAAGGGGACAGG + Intronic
1044952956 8:97451435-97451457 CTGTGTTGTGGGAAGGTTACCGG - Intergenic
1046190161 8:110784775-110784797 CTATGTTAGTGGAAGGTGAAGGG + Intergenic
1047694607 8:127391098-127391120 GTGTGTCAGGGGAAAGGGACCGG + Intergenic
1048468876 8:134689513-134689535 CTGAATTAGGGGAAGGAGGCTGG - Intronic
1049426756 8:142541192-142541214 CTCTGTCAGGGGCAGGCGGCTGG + Intronic
1053719778 9:40933764-40933786 GTGGGTTGGGGGAAGGGGACAGG + Intergenic
1056311109 9:85341877-85341899 CTGTGTTAAAGGAAGGTGAATGG - Intergenic
1056536191 9:87529803-87529825 CTGTTCTAGGGGCAGGTGACAGG - Intronic
1057453077 9:95182879-95182901 CTGGGACAGGGGAAGGTGACTGG + Intronic
1060170865 9:121459858-121459880 TTGTGTTAGGGAGAGGAGACAGG - Intergenic
1060779520 9:126401128-126401150 CAGTGTTAGGGAAAGGTCACAGG - Intronic
1062335116 9:136061517-136061539 CTGGGGTAGGGGAAGGCGGATGG + Intronic
1186112089 X:6269200-6269222 GTGTGTGAGGGGAAGGTGAGCGG - Intergenic
1189851353 X:45179173-45179195 CTTTGTTGGGGGAAGGAGGCTGG - Intronic
1191154762 X:57261307-57261329 CTTTGTTAGGGCAAGGCGGGTGG + Intergenic
1198279415 X:135126907-135126929 GTCTGTCAGGGGAAGGGGACAGG + Intergenic
1198291541 X:135245607-135245629 GTCTGTCAGGGGAAGGGGACAGG - Intergenic
1201165038 Y:11201374-11201396 ATGTGTCAGGGGCAGACGACAGG + Intergenic