ID: 1006395096

View in Genome Browser
Species Human (GRCh38)
Location 6:33782089-33782111
Sequence TCAAAGTTGATCTTGACCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 117}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006395091_1006395096 3 Left 1006395091 6:33782063-33782085 CCCTAACACAGCCAGATCCTCCT 0: 1
1: 0
2: 1
3: 10
4: 220
Right 1006395096 6:33782089-33782111 TCAAAGTTGATCTTGACCCCAGG 0: 1
1: 0
2: 0
3: 6
4: 117
1006395090_1006395096 4 Left 1006395090 6:33782062-33782084 CCCCTAACACAGCCAGATCCTCC 0: 1
1: 0
2: 1
3: 20
4: 187
Right 1006395096 6:33782089-33782111 TCAAAGTTGATCTTGACCCCAGG 0: 1
1: 0
2: 0
3: 6
4: 117
1006395088_1006395096 15 Left 1006395088 6:33782051-33782073 CCTGTCGCCTTCCCCTAACACAG 0: 1
1: 0
2: 0
3: 6
4: 131
Right 1006395096 6:33782089-33782111 TCAAAGTTGATCTTGACCCCAGG 0: 1
1: 0
2: 0
3: 6
4: 117
1006395093_1006395096 -8 Left 1006395093 6:33782074-33782096 CCAGATCCTCCTACTTCAAAGTT 0: 1
1: 0
2: 0
3: 11
4: 193
Right 1006395096 6:33782089-33782111 TCAAAGTTGATCTTGACCCCAGG 0: 1
1: 0
2: 0
3: 6
4: 117
1006395092_1006395096 2 Left 1006395092 6:33782064-33782086 CCTAACACAGCCAGATCCTCCTA 0: 1
1: 0
2: 0
3: 18
4: 294
Right 1006395096 6:33782089-33782111 TCAAAGTTGATCTTGACCCCAGG 0: 1
1: 0
2: 0
3: 6
4: 117
1006395089_1006395096 8 Left 1006395089 6:33782058-33782080 CCTTCCCCTAACACAGCCAGATC 0: 1
1: 0
2: 2
3: 18
4: 262
Right 1006395096 6:33782089-33782111 TCAAAGTTGATCTTGACCCCAGG 0: 1
1: 0
2: 0
3: 6
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006395096 Original CRISPR TCAAAGTTGATCTTGACCCC AGG Intronic
902497323 1:16882346-16882368 TCATAGTTCATCTTGATCCTTGG - Intronic
905283192 1:36862103-36862125 TCAAAGTTGAATTTGTACCCAGG + Intronic
908640300 1:66215656-66215678 TCAAAGCTGAACATGCCCCCAGG + Intronic
909575562 1:77172494-77172516 TCAAATTTGATCCTGCACCCAGG - Intronic
911774834 1:101795674-101795696 TAAATGTTGTTCTTGACTCCAGG + Intergenic
912603358 1:110962705-110962727 GCAAAGTTGAGATTAACCCCAGG + Intronic
913141693 1:115947516-115947538 TCAGAGTTGAGTTTGAACCCAGG - Intergenic
915681872 1:157589296-157589318 GAAAAGTTGACCCTGACCCCAGG - Exonic
922830510 1:228551059-228551081 TGGAAGTTTTTCTTGACCCCAGG - Intergenic
1063736709 10:8764449-8764471 TCAAAATTAATCTTGACATCTGG - Intergenic
1069331442 10:67298113-67298135 TCAAAGATGATTTTTACTCCAGG + Intronic
1071186783 10:83055771-83055793 AAAATGTTGATCTTGACCCTCGG + Intergenic
1072157829 10:92739958-92739980 TGAAAGTTGATCTTTAGGCCAGG + Intergenic
1072602702 10:96944378-96944400 TCCAATTTGAACTTGACCCAAGG - Intronic
1073957842 10:108892939-108892961 TCTAAGTTGACATTGATCCCAGG - Intergenic
1076511697 10:131018815-131018837 TTAGATTTGATCTTGACCCGGGG - Intergenic
1082009133 11:47438529-47438551 GCCAAGATGATCTTGAACCCCGG + Intronic
1090797659 11:130148834-130148856 TCGATGTTGACCTTGACCCCTGG + Intergenic
1097909866 12:64958251-64958273 TCAAACCTGTTCTTGACTCCAGG - Intergenic
1100847049 12:98670151-98670173 CCCAGGCTGATCTTGACCCCTGG + Intronic
1101694824 12:107115303-107115325 AGAAAGTTGATCATGTCCCCTGG + Intergenic
1104497742 12:129256775-129256797 TCAAACAGGATCTTGACCTCAGG + Intronic
1107719828 13:43236269-43236291 TCAAAGCTGCTCTTGAGCCTGGG + Intronic
1110786752 13:79537726-79537748 TCAAAGTGGAACTTGAATCCAGG - Intronic
1111317334 13:86580527-86580549 TCAGAGGTGATATTGACTCCAGG + Intergenic
1114558866 14:23577425-23577447 TCAAAGTCGAACTTGCCCCCGGG + Exonic
1115435798 14:33371963-33371985 ACAAAGTTGAATTTGAACCCAGG + Intronic
1116173945 14:41441310-41441332 TCAAAGTTGGACTCGAACCCTGG - Intergenic
1117507106 14:56414960-56414982 TCTAAGCTGATATTGACACCTGG + Intergenic
1119287860 14:73470600-73470622 TTATAGTTGTTCTTGGCCCCAGG - Intergenic
1124585647 15:31004033-31004055 TAAAAGTTGAATTTGTCCCCAGG + Intronic
1125836798 15:42759134-42759156 TCACAGCTGATCCTGAGCCCAGG - Intronic
1126228538 15:46298833-46298855 TGAAAGTTGATCTCCTCCCCTGG - Intergenic
1127286025 15:57534481-57534503 TCAAAGTTGAGGTTGAGCCAAGG + Intronic
1128710508 15:69867985-69868007 TCAAACCTGATCTTAACCCAGGG - Intergenic
1130241402 15:82196273-82196295 TGAGAGTTGATCTAGAACCCGGG - Intronic
1130653731 15:85777338-85777360 GCACTGTTGATCTTGACCTCAGG - Intronic
1132310982 15:100857963-100857985 TCAATGATGAGATTGACCCCTGG - Intergenic
1132386577 15:101404815-101404837 TCAGAATTGGTCTTGACCCCCGG - Intronic
1135108127 16:19668854-19668876 TCCAAGTTGAGCTTTAGCCCAGG + Intronic
1138121889 16:54406803-54406825 TGAAAGTTCATGTTGACCACAGG - Intergenic
1138534945 16:57654926-57654948 TCCAGGTTGGTCTTGACCTCCGG + Intronic
1138612349 16:58135978-58136000 TCAAAGTTAATCTTGTATCCAGG + Intergenic
1147050113 17:37787880-37787902 TCCAGGTTGGTCTTGAACCCTGG - Intergenic
1150382995 17:64735239-64735261 TCAGACTTGAGCTTGAGCCCTGG - Intergenic
1152986464 18:325922-325944 TCAAAGTTGATCTTTTCCTTTGG - Intronic
1155600154 18:27536611-27536633 AAAAAGTTGATCTTTACCTCAGG - Intergenic
1161756750 19:6139384-6139406 TCTAAGTTGAACTTGAGGCCAGG - Intronic
1164413261 19:28022795-28022817 TCAAGGTTGGACTTTACCCCTGG + Intergenic
1164517750 19:28950250-28950272 TCAAGGTTGGACTTTACCCCTGG + Intergenic
1202632864 1_KI270706v1_random:16251-16273 TCCAAGTTGAGGTTGAACCCAGG - Intergenic
925200369 2:1963094-1963116 TCAAAATTAATCCTGACCCATGG + Intronic
926199649 2:10785335-10785357 TCAAAGTTGATCTAGAACATGGG + Intronic
927982395 2:27382228-27382250 TGACTGTTGTTCTTGACCCCAGG - Exonic
932309646 2:70729263-70729285 TGCAAGGTGACCTTGACCCCTGG + Intronic
932550215 2:72761883-72761905 TCAAAGGTTCTCTTGAGCCCAGG + Intronic
933810558 2:86030359-86030381 TCAAAGTTGATCTTCATCAGAGG + Exonic
940799871 2:158121970-158121992 TCAAAAATGATCCTGTCCCCCGG + Intronic
941906755 2:170723929-170723951 TCAAATTTGAAATGGACCCCAGG + Intergenic
943748332 2:191485539-191485561 TCCAAATTTATCTTTACCCCAGG + Intergenic
943950553 2:194129031-194129053 GCAAAGTTGATGCTGAGCCCAGG - Intergenic
944388080 2:199186763-199186785 TAGAATTTGATCTTGATCCCAGG + Intergenic
947304314 2:228726506-228726528 TCAAAGTTGTTCTTCCTCCCAGG - Intergenic
1173880138 20:46406116-46406138 TCCAGGTTGAGCATGACCCCGGG + Intronic
1173948429 20:46970351-46970373 CCAGGGTTGATGTTGACCCCAGG + Intronic
1176411835 21:6453440-6453462 CCATAGTTGATCTAGACCTCTGG - Intergenic
1179687329 21:43061762-43061784 CCACAGTTGATCTAGACCTCTGG - Intronic
1180367870 22:11957103-11957125 TCCAAGTTGAGGTTGAACCCAGG + Intergenic
1182569891 22:31229086-31229108 TCAAAGTTGCCCTTAATCCCTGG - Intronic
1184848717 22:47105433-47105455 TCAAAGCTGGTCTTTACCCAGGG + Intronic
950622754 3:14219027-14219049 CCCAGGTTGATCTTGAGCCCAGG + Intergenic
956064263 3:65380122-65380144 TCAGAGTCGATGTTGACACCTGG - Intronic
956148682 3:66218859-66218881 TAAAACTTGATCATGACCGCAGG - Intronic
957430272 3:80095733-80095755 TCAAAGTAAATCATGCCCCCAGG - Intergenic
962415733 3:135179865-135179887 TCAATGTAGATCTTCATCCCTGG - Exonic
962841544 3:139237498-139237520 TCCAAGATCAGCTTGACCCCTGG + Intronic
964065588 3:152574657-152574679 TTAAAGTTGATGTTGGCCACTGG - Intergenic
969249661 4:5958622-5958644 TCAATGTTGATCCTGGCGCCGGG - Exonic
973854617 4:54998540-54998562 TTCAAGTTGATCTTGAACACAGG - Intergenic
976462517 4:85329413-85329435 TCCAATTAGAACTTGACCCCTGG - Intergenic
976756816 4:88507469-88507491 TGGAAGCTGAACTTGACCCCTGG - Intergenic
978744335 4:112174664-112174686 TCACAGTTGACTTTGATCCCAGG - Intronic
980096934 4:128501268-128501290 TCATAGCTGATCTTGGGCCCAGG - Intergenic
987875346 5:23674576-23674598 TCAAAGTTGTAGCTGACCCCCGG + Intergenic
988632973 5:32951089-32951111 TCAGAGTTTGTCTTGACCCCAGG + Intergenic
989183823 5:38603839-38603861 TCAAAGTTGAGTCTGACCACAGG - Intronic
990080509 5:51907406-51907428 TGAAAGTTTGTCTTGACACCTGG - Intergenic
995562792 5:113401431-113401453 CCAAAGGTGTACTTGACCCCTGG + Intronic
999724091 5:154420635-154420657 TCAAACTTGATCTTGAGCCAAGG + Exonic
1001164760 5:169354015-169354037 TCCAGGCTGATCTTGACCTCAGG - Intergenic
1003992467 6:11499527-11499549 TCCGAGTTGACCTTGACACCCGG - Intergenic
1006395096 6:33782089-33782111 TCAAAGTTGATCTTGACCCCAGG + Intronic
1014187519 6:118452924-118452946 TTAAAGTTGATCTTGTCCTCAGG + Intergenic
1014740084 6:125139593-125139615 TCAAAGTTTATCGTGACACGGGG + Intronic
1017534722 6:155334559-155334581 TCAAAGATGATCTAGACTTCAGG - Intergenic
1017790999 6:157799400-157799422 TCAAGGCTGATCTTGCCCCAAGG - Intronic
1020791417 7:12632651-12632673 ACAAAGTTGAGGATGACCCCTGG + Intronic
1022497778 7:30863952-30863974 TCAGAGCTGGTCCTGACCCCAGG - Intronic
1023092723 7:36631800-36631822 TCAAAGCTGATCTGTTCCCCAGG - Intronic
1023576238 7:41630469-41630491 TCAAAGCAGATCTTGAGACCAGG + Intergenic
1027729376 7:81850682-81850704 CCAAAGGTGATTTTGTCCCCAGG - Intergenic
1028319791 7:89445932-89445954 TCAAAGTTCATCTTTGCCCAAGG + Intergenic
1029601187 7:101564256-101564278 TCAGGTTTGATCTGGACCCCGGG - Intergenic
1030887804 7:114960384-114960406 GAAAAGTAGAGCTTGACCCCTGG + Intronic
1031758009 7:125671152-125671174 TCAAGGTTGCTATTGCCCCCTGG + Intergenic
1032225946 7:130031928-130031950 TGAAAGTTGATTTTGAGGCCGGG + Intronic
1033089174 7:138369401-138369423 TCAAAGGTGGTCTGGTCCCCAGG - Intergenic
1035235159 7:157492984-157493006 TCAAATTTTATGTTGATCCCTGG - Intergenic
1036085161 8:5605751-5605773 TAAATGTTGATGTTGATCCCAGG + Intergenic
1038547564 8:28437404-28437426 TGAGAGTTGATTTTGCCCCCAGG + Intronic
1040064086 8:43130253-43130275 TCATAGTTATTCTTGACTCCAGG + Intergenic
1048644530 8:136404662-136404684 TCAAAGTTGATCTCAAATCCTGG - Intergenic
1057238853 9:93391116-93391138 TCAAAGTGGAACCTGACACCTGG - Intergenic
1059530764 9:115033331-115033353 TGACAGTTGATCTTTCCCCCAGG - Intronic
1059681464 9:116590334-116590356 TCAAAGTTGAGGTTGGGCCCAGG + Intronic
1190143209 X:47866101-47866123 TGAAAATTGATCTTGGCCCTTGG + Intronic
1190537991 X:51448111-51448133 TCAAATTTGTTCCTGGCCCCAGG + Intergenic
1200322462 X:155203940-155203962 TAGAATTTGATCTTGATCCCAGG - Intronic
1201528584 Y:14964742-14964764 TCCAAGCTGATCCTGAACCCTGG + Intergenic
1202082868 Y:21102711-21102733 TCAAACTTGAGCTTGCCTCCTGG - Intergenic
1202169409 Y:22025231-22025253 TCAAAAGTGATCTTGCCACCTGG - Intergenic
1202221956 Y:22561134-22561156 TCAAAAGTGATCTTGCCACCTGG + Intergenic
1202321162 Y:23634533-23634555 TCAAAAGTGATCTTGCCACCTGG - Intergenic
1202549605 Y:26035523-26035545 TCAAAAGTGATCTTGCCACCTGG + Intergenic