ID: 1006395097

View in Genome Browser
Species Human (GRCh38)
Location 6:33782090-33782112
Sequence CAAAGTTGATCTTGACCCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 150}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006395093_1006395097 -7 Left 1006395093 6:33782074-33782096 CCAGATCCTCCTACTTCAAAGTT 0: 1
1: 0
2: 0
3: 11
4: 193
Right 1006395097 6:33782090-33782112 CAAAGTTGATCTTGACCCCAGGG 0: 1
1: 0
2: 0
3: 9
4: 150
1006395089_1006395097 9 Left 1006395089 6:33782058-33782080 CCTTCCCCTAACACAGCCAGATC 0: 1
1: 0
2: 2
3: 18
4: 262
Right 1006395097 6:33782090-33782112 CAAAGTTGATCTTGACCCCAGGG 0: 1
1: 0
2: 0
3: 9
4: 150
1006395090_1006395097 5 Left 1006395090 6:33782062-33782084 CCCCTAACACAGCCAGATCCTCC 0: 1
1: 0
2: 1
3: 20
4: 187
Right 1006395097 6:33782090-33782112 CAAAGTTGATCTTGACCCCAGGG 0: 1
1: 0
2: 0
3: 9
4: 150
1006395092_1006395097 3 Left 1006395092 6:33782064-33782086 CCTAACACAGCCAGATCCTCCTA 0: 1
1: 0
2: 0
3: 18
4: 294
Right 1006395097 6:33782090-33782112 CAAAGTTGATCTTGACCCCAGGG 0: 1
1: 0
2: 0
3: 9
4: 150
1006395088_1006395097 16 Left 1006395088 6:33782051-33782073 CCTGTCGCCTTCCCCTAACACAG 0: 1
1: 0
2: 0
3: 6
4: 131
Right 1006395097 6:33782090-33782112 CAAAGTTGATCTTGACCCCAGGG 0: 1
1: 0
2: 0
3: 9
4: 150
1006395091_1006395097 4 Left 1006395091 6:33782063-33782085 CCCTAACACAGCCAGATCCTCCT 0: 1
1: 0
2: 1
3: 10
4: 220
Right 1006395097 6:33782090-33782112 CAAAGTTGATCTTGACCCCAGGG 0: 1
1: 0
2: 0
3: 9
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006395097 Original CRISPR CAAAGTTGATCTTGACCCCA GGG Intronic
901863382 1:12088809-12088831 CAAAGCTGAGCTTTACCCAAGGG - Intronic
904046151 1:27609801-27609823 CTAATTTGATCTTCACCACAAGG - Intergenic
904398896 1:30242912-30242934 CAAAGTTGAAGGAGACCCCAGGG + Intergenic
909999176 1:82321716-82321738 CCAAGCTGGTCTTGACCTCATGG + Intergenic
912073911 1:105848914-105848936 CCAAGTTGATCTTGAACTCCTGG + Intergenic
912465240 1:109868209-109868231 CAAAGCTGATCCTGACCCACAGG + Intergenic
914373102 1:147048157-147048179 CAAAGTGGAACTTGAACTCATGG - Intergenic
915014855 1:152723643-152723665 GAAAGTGTAGCTTGACCCCAAGG + Intergenic
921654885 1:217722992-217723014 CTAAGTCCCTCTTGACCCCATGG - Intronic
921786253 1:219233556-219233578 CCAAGTTGATCTTGAACTCCTGG - Intergenic
1065018891 10:21486261-21486283 CAAAGTGGATCCTGTCTCCAGGG + Intergenic
1065812293 10:29453296-29453318 CTAAGCTGATCTTGACCTCTTGG + Intergenic
1065875517 10:29994203-29994225 CAGAGGTGATTTTGCCCCCAAGG - Intergenic
1067829515 10:49602338-49602360 GATAGATGATCTTGAACCCATGG + Intergenic
1069488246 10:68839430-68839452 CAAAGCTGGTCTTGAACCCCTGG + Intronic
1069671366 10:70207457-70207479 CCAGGCTGATCTTGACCCCCTGG - Intronic
1070751087 10:78964272-78964294 TATAGTTGTTCTTGACCCCCAGG - Intergenic
1073664771 10:105518780-105518802 GAAAGTAGAGCTTGATCCCAAGG + Intergenic
1078150524 11:8755849-8755871 TAAAGTCAATCTTGCCCCCAGGG + Intronic
1079000981 11:16755845-16755867 CAAAGTTAATTTTGTCCCAAAGG + Exonic
1080310929 11:30890989-30891011 CAAAGCAGAACTTGATCCCAAGG - Intronic
1082009135 11:47438530-47438552 CCAAGATGATCTTGAACCCCGGG + Intronic
1083676940 11:64331467-64331489 CCAAGTTGGTCTTGAACCCCTGG + Intergenic
1085014728 11:73166335-73166357 CAAAGTAAATCTTTACCTCAAGG - Intergenic
1097584410 12:61498430-61498452 CAAAGTCTCTCTTGTCCCCAAGG + Intergenic
1100847051 12:98670152-98670174 CCAGGCTGATCTTGACCCCTGGG + Intronic
1101513928 12:105417424-105417446 CAAATTTGACCTTTACCCCTTGG + Intergenic
1101694825 12:107115304-107115326 GAAAGTTGATCATGTCCCCTGGG + Intergenic
1102276708 12:111587982-111588004 CCATGTTGATCTTGAACTCATGG - Intronic
1107674957 13:42785978-42786000 CAGGGATGATTTTGACCCCAGGG - Intronic
1109955018 13:69554253-69554275 CATAGTTTATCTTGACCATATGG + Intergenic
1111317335 13:86580528-86580550 CAGAGGTGATATTGACTCCAGGG + Intergenic
1111629030 13:90826287-90826309 CAAAGGGGCTATTGACCCCATGG + Intergenic
1112281933 13:98070490-98070512 CCAAGTTGATCTTGAACTCCTGG - Intergenic
1114520110 14:23328484-23328506 CCAAGTTGATCTTGAACTCTTGG + Intergenic
1114558867 14:23577426-23577448 CAAAGTCGAACTTGCCCCCGGGG + Exonic
1116370082 14:44119443-44119465 CAAAGTTAATTTTGTCCCAAAGG - Intergenic
1117163551 14:53012100-53012122 CAAGCTTCACCTTGACCCCATGG - Intergenic
1119287859 14:73470599-73470621 TATAGTTGTTCTTGGCCCCAGGG - Intergenic
1120269689 14:82295891-82295913 CCAAGTTGATCTTGAACTCCTGG + Intergenic
1121401315 14:93680315-93680337 CAAACCTTATCTTGACCTCAAGG + Intronic
1126124956 15:45286881-45286903 CCAAGTTGGTCTTGAACCCCTGG - Intergenic
1126914520 15:53451011-53451033 GAAAGTTGATCTGGAGCCTATGG - Intergenic
1127032933 15:54884036-54884058 CAAGCCTGATCTTGACCGCAAGG + Intergenic
1132386576 15:101404814-101404836 CAGAATTGGTCTTGACCCCCGGG - Intronic
1133505827 16:6411190-6411212 CCAAGTTGGTCTTGAACCCCTGG + Intronic
1133874684 16:9722691-9722713 CAAAGGTGATCCTATCCCCAGGG - Intergenic
1134450115 16:14358122-14358144 CCAAGTTGATCTTGAACTCCTGG - Intergenic
1137848270 16:51713061-51713083 CAAAGTGATTCTTGCCCCCAAGG + Intergenic
1138121888 16:54406802-54406824 GAAAGTTCATGTTGACCACAGGG - Intergenic
1139757658 16:69157804-69157826 CAAAGTTGGTCTTGAACTCCTGG + Intronic
1146089544 17:29862580-29862602 CCATGTTGATCTGGAGCCCAAGG - Intronic
1146477616 17:33175842-33175864 AAAGGTTGATCTTGGCCGCAAGG - Intronic
1150858908 17:68780265-68780287 CAAAGATGAATCTGACCCCAGGG - Intergenic
1151526177 17:74670369-74670391 CCATGTTGATATTGACTCCAAGG + Intergenic
1153287095 18:3466771-3466793 TAAAGCTGATCTTTACCTCATGG - Intergenic
1155600153 18:27536610-27536632 AAAAGTTGATCTTTACCTCAGGG - Intergenic
1164949591 19:32326119-32326141 CAAAGTTGATCTTGAACTCTTGG - Intergenic
1166997317 19:46725869-46725891 CAAAGGTGAGCCTGACCCCTTGG + Intronic
1167233281 19:48298263-48298285 CCATGCTGGTCTTGACCCCAAGG + Exonic
1167947647 19:53001882-53001904 CAAAGTTGGGCTGGACGCCATGG + Intergenic
1168692249 19:58384288-58384310 CAAACTTGATCTTGTGCCCATGG - Intergenic
926578140 2:14605362-14605384 CAAAGTTGATTTAGACTTCAAGG - Intergenic
927635816 2:24815786-24815808 TTAAGTTGATCTTGGGCCCACGG - Intronic
927784068 2:25960192-25960214 CCAAGCTGATCTTGAACCCCTGG - Intronic
929566326 2:42988071-42988093 CCAAGTTGGTCTTGACCTCCTGG + Intergenic
930794766 2:55377365-55377387 CCAAGTTGATCTTGAACTCCTGG + Intronic
931284602 2:60821353-60821375 AAAAGGTGATATTGCCCCCAAGG - Intergenic
932799458 2:74726949-74726971 CTAAGCTGATCTTGAACCCCTGG + Intergenic
933344286 2:81064023-81064045 CAAAGTTTGTCTGAACCCCATGG - Intergenic
933697149 2:85228208-85228230 CCAAGATGATCTTGAACCCGTGG - Intronic
933810559 2:86030360-86030382 CAAAGTTGATCTTCATCAGAGGG + Exonic
935628823 2:105195066-105195088 CAAAGCTGGTCTTGACCTCCTGG - Intergenic
936044545 2:109176520-109176542 CAAGGCTGATCTTGAACCCCTGG - Intronic
944190254 2:196995342-196995364 TAAAGTTGGACTTGAACCCAGGG - Intronic
944388081 2:199186764-199186786 AGAATTTGATCTTGATCCCAGGG + Intergenic
945694533 2:213086492-213086514 CAAAAGTGATCCTGATCCCATGG + Intronic
946362017 2:219224617-219224639 CAAAGTTGTACTTGAGACCACGG + Exonic
948757696 2:240168905-240168927 CCAAGCTGCTCCTGACCCCAAGG - Intergenic
1173948430 20:46970352-46970374 CAGGGTTGATGTTGACCCCAGGG + Intronic
1175477715 20:59288615-59288637 CAAAGGTGATCTGGACCCTGAGG - Intergenic
1176411834 21:6453439-6453461 CATAGTTGATCTAGACCTCTGGG - Intergenic
1177066821 21:16447800-16447822 AAAAGTTTATCTTCACCCTAAGG + Intergenic
1179653981 21:42833875-42833897 CAATGTTGACCTTGAGCACAAGG - Intergenic
1179687328 21:43061761-43061783 CACAGTTGATCTAGACCTCTGGG - Intronic
1182882696 22:33747242-33747264 CAAAGTGGATCTTGGCACCTTGG - Intronic
1183870130 22:40735349-40735371 CCAAGTTGGTCTTGAACTCATGG - Intergenic
950219440 3:11183349-11183371 CAGAGGTGGTCTTGACCCTAGGG + Intronic
950622756 3:14219028-14219050 CCAGGTTGATCTTGAGCCCAGGG + Intergenic
952084590 3:29802357-29802379 CAAAGTTGACCTTTAGTCCAAGG + Intronic
953644892 3:44744900-44744922 CCAAGCTGGTCTTGACCCCCTGG + Intronic
954547323 3:51448429-51448451 CCAAGTTGATCTTGAACTCCTGG + Intronic
960661163 3:120060515-120060537 CCAAGTTGTTCTTGACCTCCTGG - Intronic
962292525 3:134148499-134148521 CAAAGCTGTTCTTGATCCCTAGG - Intronic
964428195 3:156575438-156575460 CAAAATTGATCTTTTCTCCAGGG - Intergenic
966247058 3:177820722-177820744 CAAACTTGATCTTGACTTTAAGG + Intergenic
968856879 4:3131744-3131766 TAAAGTTCCTCTTGACACCACGG + Exonic
972513247 4:39789367-39789389 CCAAGCTGATCTTGAACCCCTGG - Intergenic
974086309 4:57264700-57264722 CAAGGATGATTTTGCCCCCAGGG - Intergenic
976738697 4:88336422-88336444 CCAGGTTGATCTTGAACCCCTGG - Intergenic
977691453 4:99916345-99916367 CTAGGTTGATCTTGAACCCATGG + Intronic
981350424 4:143723001-143723023 CAGGGGTGATCTTGACCCCCAGG - Intergenic
982012851 4:151123576-151123598 CAAATTTGATATTGAGGCCATGG - Intronic
984636661 4:182118488-182118510 CCAAGTTGATCTTGAACTCCTGG + Intergenic
985867887 5:2529566-2529588 GACAGTTGACCTTGACACCATGG - Intergenic
988632974 5:32951090-32951112 CAGAGTTTGTCTTGACCCCAGGG + Intergenic
990374859 5:55159224-55159246 CCAAGTTGGTCTTGAACTCATGG + Intronic
990900260 5:60742029-60742051 CAAAGTTGCTCTTATCCCCCAGG - Intergenic
991436459 5:66601365-66601387 CAGAGATGGTTTTGACCCCAGGG + Intronic
996035692 5:118756292-118756314 GAAAGTTGATCTAGCCCCCCAGG - Intergenic
999116220 5:149165992-149166014 CAAAGTTTATTTTGTCCTCATGG + Intronic
999430471 5:151521354-151521376 CACAGTGCATCTGGACCCCAAGG - Exonic
1000051466 5:157566879-157566901 CAAAGCTGATCTTGAACTCCTGG + Intronic
1000479251 5:161751289-161751311 CCAACTTGATCTTAACCACAGGG - Intergenic
1000983992 5:167847160-167847182 CCAAGTTGATCTTGAACTCCTGG + Intronic
1001669399 5:173461395-173461417 CAACCTTGATTTTGACCTCAAGG - Intergenic
1001748969 5:174113547-174113569 CAAAGTTAACCTTGACCCCTTGG + Intronic
1002146293 5:177184743-177184765 CAAAGTTGATCTTGAAATCCTGG + Intronic
1003964774 6:11242364-11242386 CAAGGGTGTTCTTGAACCCAGGG + Intronic
1004545662 6:16596204-16596226 CAAAGCTGATCTTGAACTCCTGG + Intronic
1004686110 6:17946163-17946185 CAAGGCTGATCTTGAACCCCTGG + Intronic
1006395097 6:33782090-33782112 CAAAGTTGATCTTGACCCCAGGG + Intronic
1009860935 6:69331161-69331183 CAGAGATGATTTTGACCCCCCGG - Intronic
1011073764 6:83415760-83415782 CAAAGTTGATCTTGAATGCCTGG - Intronic
1011892429 6:92181972-92181994 TAAAGTTGATCAAGACCCCTAGG + Intergenic
1016895605 6:149048938-149048960 CTAACTTGCTCTTTACCCCAGGG - Intronic
1017534721 6:155334558-155334580 CAAAGATGATCTAGACTTCAGGG - Intergenic
1020791418 7:12632652-12632674 CAAAGTTGAGGATGACCCCTGGG + Intronic
1026620287 7:71944235-71944257 CCAAGTTGATCTTGAACTCCTGG - Intronic
1026966378 7:74442668-74442690 CCAAGTTGGTCTTGACCTCCTGG - Intergenic
1027729375 7:81850681-81850703 CAAAGGTGATTTTGTCCCCAGGG - Intergenic
1028319792 7:89445933-89445955 CAAAGTTCATCTTTGCCCAAGGG + Intergenic
1028879212 7:95860550-95860572 CAAAGTAGGTCAAGACCCCAAGG - Intronic
1029175089 7:98658937-98658959 CAATGTCTATCTTGAGCCCATGG - Intergenic
1029524248 7:101085544-101085566 CAGAGCTGATCTTGACCTCTAGG - Exonic
1029946644 7:104540333-104540355 CAAAGCTGATTTTGCCCCCCAGG + Intronic
1030271837 7:107676962-107676984 CCAAGCTGATCTTGAACTCATGG - Intronic
1033430251 7:141282504-141282526 CAAAGTTGTTCTTCACCCTCAGG - Intronic
1034469418 7:151247579-151247601 CAAATTTGGTTGTGACCCCAAGG - Intronic
1034518588 7:151601468-151601490 CAAAGCTGATCCTGAGACCATGG + Intronic
1035692585 8:1569926-1569948 CAGGGTAGATCTTCACCCCATGG + Intronic
1037321368 8:17646376-17646398 CCAAGTTGATCTTGAACTCCTGG - Intronic
1038513020 8:28158440-28158462 CAAACTTAATTTTGAGCCCAGGG + Intronic
1038861953 8:31397356-31397378 CAGAGTTGATCTTAAGACCATGG + Intergenic
1042319053 8:67455922-67455944 CTGAGTTGATCTTGACCTCCTGG + Intronic
1042571527 8:70170720-70170742 AAAAGTTGTTCTTGGCCCCGTGG - Intronic
1044643261 8:94408910-94408932 CATAGATGATCTTGATCCAAAGG + Intronic
1046032942 8:108805203-108805225 CAAAGTTCATTTTGATCACATGG - Intergenic
1046423878 8:114020356-114020378 CCAAGTTGGTCTTGAACCCCTGG + Intergenic
1047472773 8:125195180-125195202 CACAGTTGATATTGACGCCTAGG - Intronic
1055382118 9:75719120-75719142 GAAAGATTATCTTGACCCTAAGG + Intergenic
1055842583 9:80523174-80523196 CAAAGTGTATTTTGACCACAGGG - Intergenic
1058452811 9:105112991-105113013 CAAAGCTGATCTTGAACTCCTGG - Intergenic
1059530763 9:115033330-115033352 GACAGTTGATCTTTCCCCCAGGG - Intronic
1059671737 9:116498373-116498395 CCAAGCTGATCTTGACCTCCTGG - Intronic
1187292312 X:17967023-17967045 AAAACTTGATCTTGCCCACAAGG + Intergenic
1190187062 X:48244454-48244476 CCAAGTTGGTCTTGACCTCTTGG + Intronic
1195230108 X:102838397-102838419 CAAAATTAAGCTTGACCTCAGGG + Intergenic
1200322461 X:155203939-155203961 AGAATTTGATCTTGATCCCAGGG - Intronic
1201423282 Y:13822427-13822449 CAGAGGTGATTTTGTCCCCAAGG + Intergenic