ID: 1006395098

View in Genome Browser
Species Human (GRCh38)
Location 6:33782091-33782113
Sequence AAAGTTGATCTTGACCCCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 2, 3: 5, 4: 109}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006395090_1006395098 6 Left 1006395090 6:33782062-33782084 CCCCTAACACAGCCAGATCCTCC 0: 1
1: 0
2: 1
3: 20
4: 187
Right 1006395098 6:33782091-33782113 AAAGTTGATCTTGACCCCAGGGG 0: 1
1: 0
2: 2
3: 5
4: 109
1006395089_1006395098 10 Left 1006395089 6:33782058-33782080 CCTTCCCCTAACACAGCCAGATC 0: 1
1: 0
2: 2
3: 18
4: 262
Right 1006395098 6:33782091-33782113 AAAGTTGATCTTGACCCCAGGGG 0: 1
1: 0
2: 2
3: 5
4: 109
1006395091_1006395098 5 Left 1006395091 6:33782063-33782085 CCCTAACACAGCCAGATCCTCCT 0: 1
1: 0
2: 1
3: 10
4: 220
Right 1006395098 6:33782091-33782113 AAAGTTGATCTTGACCCCAGGGG 0: 1
1: 0
2: 2
3: 5
4: 109
1006395088_1006395098 17 Left 1006395088 6:33782051-33782073 CCTGTCGCCTTCCCCTAACACAG 0: 1
1: 0
2: 0
3: 6
4: 131
Right 1006395098 6:33782091-33782113 AAAGTTGATCTTGACCCCAGGGG 0: 1
1: 0
2: 2
3: 5
4: 109
1006395093_1006395098 -6 Left 1006395093 6:33782074-33782096 CCAGATCCTCCTACTTCAAAGTT 0: 1
1: 0
2: 0
3: 11
4: 193
Right 1006395098 6:33782091-33782113 AAAGTTGATCTTGACCCCAGGGG 0: 1
1: 0
2: 2
3: 5
4: 109
1006395092_1006395098 4 Left 1006395092 6:33782064-33782086 CCTAACACAGCCAGATCCTCCTA 0: 1
1: 0
2: 0
3: 18
4: 294
Right 1006395098 6:33782091-33782113 AAAGTTGATCTTGACCCCAGGGG 0: 1
1: 0
2: 2
3: 5
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006395098 Original CRISPR AAAGTTGATCTTGACCCCAG GGG Intronic
901414252 1:9105908-9105930 AAGATGGATCTTGACCCCTGAGG + Intronic
903469608 1:23576821-23576843 AGGGTTGATTTTGCCCCCAGAGG - Intergenic
903636742 1:24824142-24824164 AAAGTTGATTTTGAACCTACTGG + Intronic
905284078 1:36868032-36868054 ACCTTCGATCTTGACCCCAGTGG - Intronic
905825733 1:41024649-41024671 ACATTTAATTTTGACCCCAGAGG + Intergenic
906635288 1:47405707-47405729 GAAGTGGCTCTTGACCACAGAGG + Intergenic
907575967 1:55526040-55526062 AAAGTTGATCTTGGTGGCAGGGG + Intergenic
908357051 1:63332263-63332285 AAAGTTGCTCTTGTTCCTAGAGG + Intergenic
919687095 1:200493951-200493973 CAAGCTGAACTTGACCACAGAGG + Intergenic
921641666 1:217562082-217562104 AAGGTTGATCTTGACTGCTGGGG - Intronic
1066438678 10:35416819-35416841 AGAGTTGATTTTGCCCCCACAGG - Intronic
1070751086 10:78964271-78964293 ATAGTTGTTCTTGACCCCCAGGG - Intergenic
1072328447 10:94321936-94321958 AGAGGTGATCTTGAGCTCAGAGG + Exonic
1074211089 10:111335754-111335776 AAAGATGATATTAACCCAAGAGG - Intergenic
1078286608 11:9962142-9962164 AAAGTTGTTGTTTCCCCCAGTGG - Intronic
1078563507 11:12393724-12393746 AATTTTGTTCTTGGCCCCAGGGG + Intronic
1082009136 11:47438531-47438553 CAAGATGATCTTGAACCCCGGGG + Intronic
1086669616 11:89531174-89531196 AAAGATCAAGTTGACCCCAGAGG + Intergenic
1089355853 11:117853103-117853125 AAAGTAGATTTTGACCCCCAAGG - Intronic
1101612507 12:106303937-106303959 CAAGTTGTCCTTGTCCCCAGTGG + Intronic
1101999583 12:109548582-109548604 AAACTGGATTTTGACACCAGAGG + Intergenic
1106830857 13:33581378-33581400 AGAGTTGATCTTGGGCCCACTGG - Intergenic
1107323405 13:39213360-39213382 AAAGATGATCTTGACCTTGGAGG - Intergenic
1107674956 13:42785977-42785999 AGGGATGATTTTGACCCCAGGGG - Intronic
1110416254 13:75256336-75256358 AAAGTTGGTCTTAACCCCTAAGG - Intergenic
1110689348 13:78413669-78413691 ACAATTGATTTTGCCCCCAGTGG - Intergenic
1111691673 13:91571169-91571191 AAAGTTGATATTGACTCTGGAGG - Intronic
1114558868 14:23577427-23577449 AAAGTCGAACTTGCCCCCGGGGG + Exonic
1116660115 14:47699441-47699463 AAAATTGATAGTGAGCCCAGTGG + Intergenic
1116937124 14:50752282-50752304 AAAGTCCATCTTTACCCCAGTGG + Intronic
1116991548 14:51282476-51282498 AAAGTACATCTTTGCCCCAGTGG + Intergenic
1118356089 14:65015051-65015073 AAAGATGACCCTGAACCCAGTGG - Intronic
1121832106 14:97061465-97061487 CAAGCTGATCTGTACCCCAGAGG + Intergenic
1131444008 15:92480651-92480673 AAAGCTGATCTGCACCTCAGTGG - Intronic
1133874683 16:9722690-9722712 AAAGGTGATCCTATCCCCAGGGG - Intergenic
1134641628 16:15833710-15833732 AAAGTTTATCTTCATCACAGAGG + Intronic
1138121887 16:54406801-54406823 AAAGTTCATGTTGACCACAGGGG - Intergenic
1142990358 17:3726128-3726150 AAGGGTGATATTCACCCCAGCGG - Exonic
1147784607 17:42970152-42970174 AAATTTGAGTTTGACCCAAGAGG - Intronic
1148821673 17:50363654-50363676 AATCCTGATTTTGACCCCAGTGG - Intergenic
1153106730 18:1536590-1536612 AAAGTTAACCTTGACCCCAGAGG - Intergenic
1157566094 18:48680209-48680231 AAAGTAGGACTTGGCCCCAGTGG + Intronic
1159259744 18:65998247-65998269 AAATTTGATCTTGACATGAGAGG - Intergenic
1160549457 18:79684119-79684141 AAGGTGGCTCTTGACCCCACTGG + Intronic
1161280619 19:3443685-3443707 ATGGGTGATCCTGACCCCAGAGG + Intronic
1161565020 19:4997129-4997151 AAGGCTGATCGTGCCCCCAGAGG - Intronic
1164102591 19:22070736-22070758 AATGCTGATCATGAGCCCAGGGG + Intronic
1164949590 19:32326118-32326140 AAAGTTGATCTTGAACTCTTGGG - Intergenic
1168264217 19:55212893-55212915 AAACTTGCTCTTGACCTGAGAGG - Intergenic
928660589 2:33498357-33498379 AGAGTTGAATTTGATCCCAGTGG + Intronic
929124780 2:38513177-38513199 AGAGCTGATCCTGACCACAGTGG - Intergenic
931083748 2:58805463-58805485 GAAGATGATCTTGACCCAAAAGG - Intergenic
931284601 2:60821352-60821374 AAAGGTGATATTGCCCCCAAGGG - Intergenic
933149350 2:78895230-78895252 ATAGTGTGTCTTGACCCCAGGGG - Intergenic
935308002 2:101756513-101756535 AAAGATGAACCAGACCCCAGAGG - Intronic
935826349 2:106954199-106954221 ATAGCTAGTCTTGACCCCAGAGG + Intergenic
941456593 2:165716726-165716748 AAAGTTGATCTTGACACAAGAGG - Intergenic
946699174 2:222393685-222393707 AAAGTAGGGTTTGACCCCAGAGG - Intergenic
1169163451 20:3402829-3402851 AAAGTTGATCTTGGCCCTGGTGG - Intronic
1169691629 20:8339276-8339298 AAAGATGGTCTTGATCACAGTGG + Intronic
1171334730 20:24373279-24373301 CCAGTTGGTCTTGGCCCCAGGGG - Intergenic
1171542717 20:25976785-25976807 GGAGGTGATTTTGACCCCAGCGG - Intergenic
1172591309 20:36119950-36119972 AGAGGTGAACTTGAGCCCAGGGG + Intronic
1172788878 20:37488637-37488659 AAAGGTGATTTTGACACAAGTGG - Intergenic
1172934032 20:38606789-38606811 TCAGTTGACATTGACCCCAGTGG - Intronic
1173948431 20:46970353-46970375 AGGGTTGATGTTGACCCCAGGGG + Intronic
1176411833 21:6453438-6453460 ATAGTTGATCTAGACCTCTGGGG - Intergenic
1176518060 21:7801109-7801131 GAAGTTGAACTTGACTCCAAAGG - Intergenic
1177066822 21:16447801-16447823 AAAGTTTATCTTCACCCTAAGGG + Intergenic
1178652088 21:34431122-34431144 GAAGTTGAACTTGACTCCAAAGG - Intergenic
1179687327 21:43061760-43061782 ACAGTTGATCTAGACCTCTGGGG - Intronic
949820752 3:8112852-8112874 AAAGTTGCGCTTGAGTCCAGGGG - Intergenic
951749478 3:26017996-26018018 AATGTGGATCTTGACCCTAAAGG + Intergenic
953079291 3:39600407-39600429 AAATTTGATCAGGACTCCAGGGG + Intergenic
958812339 3:98875793-98875815 AAAGTTTATCTTTGTCCCAGTGG - Intronic
961148578 3:124616560-124616582 AATGTAGATGATGACCCCAGAGG - Intronic
963315708 3:143756263-143756285 AAAGCTGATCTTCACAACAGTGG + Intronic
970829426 4:20319614-20319636 AAATGTGATCTTGACCCTTGTGG - Intronic
973839595 4:54847585-54847607 TATCTTGAACTTGACCCCAGTGG - Intergenic
974330912 4:60477457-60477479 ACAATGGATCTTGGCCCCAGTGG + Intergenic
976213690 4:82695381-82695403 AAAGTTGATCTTGAACTAAAAGG + Intronic
977691454 4:99916346-99916368 TAGGTTGATCTTGAACCCATGGG + Intronic
979180820 4:117724359-117724381 TAAGTTGATATTGACTCTAGGGG - Intergenic
986535163 5:8779043-8779065 ACAGATGATCTTGATTCCAGGGG - Intergenic
994795015 5:104286440-104286462 AAGTGTGATTTTGACCCCAGGGG - Intergenic
994991500 5:107002451-107002473 AAAGTAGATCTTAACCCTAAAGG - Intergenic
996035691 5:118756291-118756313 AAAGTTGATCTAGCCCCCCAGGG - Intergenic
996538347 5:124602120-124602142 AAAGTCAATCTTGACAGCAGTGG + Intergenic
996823857 5:127659781-127659803 AAATTAGATCTTGACCTGAGAGG + Intergenic
1006395098 6:33782091-33782113 AAAGTTGATCTTGACCCCAGGGG + Intronic
1006970109 6:38034715-38034737 AAAGTTGATCTAGACAAAAGAGG + Intronic
1009812283 6:68683619-68683641 AAAATTCATCTTGATTCCAGTGG - Intronic
1013661154 6:112298252-112298274 CACATTCATCTTGACCCCAGAGG + Intergenic
1015280189 6:131425513-131425535 ATAGTTGCTCTTTAGCCCAGTGG + Intergenic
1015927000 6:138320611-138320633 AAGGAGGATGTTGACCCCAGGGG + Intronic
1016895604 6:149048937-149048959 TAACTTGCTCTTTACCCCAGGGG - Intronic
1018874309 6:167806497-167806519 AAACTTGACCTTTGCCCCAGAGG + Intergenic
1022625930 7:32035930-32035952 AAATTTCATCTTGACCCCCTTGG + Intronic
1025603937 7:63025253-63025275 AAAGGGGATTTTGTCCCCAGGGG - Intergenic
1029340589 7:99940734-99940756 GAACTTGATCTTGTCCACAGGGG + Intergenic
1035118224 7:156542995-156543017 AAAGGTGATTTTTGCCCCAGAGG + Intergenic
1035186298 7:157128636-157128658 AATGTAGATTTGGACCCCAGAGG - Intergenic
1041183831 8:55277153-55277175 ATAGTTCATATTGACCTCAGTGG - Intronic
1043800840 8:84607798-84607820 AAAATGAACCTTGACCCCAGAGG - Intronic
1049579133 8:143403161-143403183 AAAGGTGATCTCTGCCCCAGGGG - Intergenic
1051188842 9:14489074-14489096 AAAGTTCATCTTTCCTCCAGCGG + Intergenic
1051587855 9:18746106-18746128 AAAGCTCAGCTTGACACCAGTGG + Intronic
1052460171 9:28752855-28752877 ATAGCTGACCTTGGCCCCAGAGG - Intergenic
1052768731 9:32668230-32668252 AAAGTGGTTTTTCACCCCAGTGG - Intergenic
1055587695 9:77772455-77772477 TAAATTAATATTGACCCCAGTGG - Intronic
1060720841 9:125976079-125976101 AAAGTTCATCTTTGCCCCACTGG + Intergenic
1187447270 X:19370926-19370948 AAAGCTGACCTTGACCACAAAGG + Intronic
1188533471 X:31168136-31168158 AAGCTTGAGCTTGACCCCAAAGG + Intronic
1189558651 X:42170443-42170465 AAAGTTGTCCTTGACTCCAGAGG - Intergenic
1190142665 X:47861831-47861853 AAATTCTATCTTGACCCCAAAGG + Intronic
1192905412 X:75545843-75545865 GAAGTTTATCTTGCTCCCAGTGG + Intergenic
1193183454 X:78484976-78484998 AAAGTTAATCATGTCCCCTGAGG - Intergenic