ID: 1006397870

View in Genome Browser
Species Human (GRCh38)
Location 6:33798752-33798774
Sequence CTGTGCAAACAGCTGGAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 325
Summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 289}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006397870_1006397874 0 Left 1006397870 6:33798752-33798774 CCTTGCTCCAGCTGTTTGCACAG 0: 1
1: 0
2: 2
3: 33
4: 289
Right 1006397874 6:33798775-33798797 GTGGCTCCTTCCCTTCATTCAGG 0: 1
1: 0
2: 7
3: 48
4: 390

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006397870 Original CRISPR CTGTGCAAACAGCTGGAGCA AGG (reversed) Intronic
900811370 1:4803797-4803819 CTGAGCAAACAGCTCAAGCATGG - Intergenic
902554715 1:17240152-17240174 CTGTGGGAACAGGTGAAGCAAGG + Intronic
903577820 1:24350139-24350161 CTGAGCAACCAGCTGGGGGAGGG - Intronic
905067926 1:35199233-35199255 CTGTGCAAAGAGCCGGGGCGGGG - Intergenic
905395986 1:37666945-37666967 GTGTGCAAACAGCTGCACCCTGG + Intergenic
905910038 1:41647431-41647453 CTGTGGAAACAGCTTGTGCCCGG - Intronic
906475885 1:46169013-46169035 CTGTGAAAAAAGCTGAACCAAGG - Intronic
906616164 1:47234267-47234289 CTGAGGAAACAGCTGGACCAAGG + Intergenic
907427769 1:54391729-54391751 CTGTGCAAACAGCTGTCACCAGG + Intronic
907583289 1:55591516-55591538 CTCTGCCAACAGCTTGATCATGG - Intergenic
907629848 1:56069526-56069548 CAGTGGAAAGAGCAGGAGCAAGG + Intergenic
908342047 1:63191635-63191657 CTGTCCAAACAGATGGACAAGGG - Intergenic
909884571 1:80924840-80924862 CTGTGCAAATCTCTGGAACATGG - Intergenic
911102334 1:94104584-94104606 CTGTCCATGCAGCTGGGGCAGGG + Intronic
911884019 1:103274638-103274660 CTGAGCACACACCTTGAGCAGGG + Intergenic
912681900 1:111734129-111734151 CTGTGCCAAGAGCTGTAGGAGGG + Intronic
913159117 1:116129337-116129359 CTGTGCAGCCTGCTGGAGTAGGG + Intronic
914069659 1:144276195-144276217 CTGTACCAGCAGCTGGCGCAGGG - Intergenic
914109496 1:144690159-144690181 CTGTACCAGCAGCTGGCGCAGGG + Intergenic
915197331 1:154199493-154199515 CTTTTCAAACAGCTGGTGCAGGG + Exonic
916246845 1:162696797-162696819 CTGGGCAGACAGCGGGGGCAGGG - Intronic
918937207 1:190937089-190937111 CTGTAGAAATAGCTGGATCATGG + Intergenic
920645494 1:207800624-207800646 CTGTGCAAAAAGCCTGATCAAGG + Intergenic
920806864 1:209242934-209242956 CCTTGTCAACAGCTGGAGCAAGG - Intergenic
922212684 1:223497779-223497801 CAGTGCAAAAAGCTGGAGCCAGG + Intergenic
922468343 1:225860205-225860227 CTGTGCAAGGAGCTGAGGCAGGG + Intronic
922689531 1:227677335-227677357 ATGTGCAAACAGCTGAACAAAGG + Intronic
922725461 1:227920964-227920986 CGGGGCGTACAGCTGGAGCAGGG - Exonic
1062965979 10:1608165-1608187 CTGTGCCAACGTCTGGAGCGGGG + Intronic
1063327897 10:5123329-5123351 CTGTGCTACCAGCTGCAGCGTGG - Intronic
1063442455 10:6084004-6084026 CTGTTCAAAGCGTTGGAGCAAGG + Intergenic
1067247294 10:44557551-44557573 CTGTCCAAACAGCAAGTGCAGGG - Intergenic
1067671912 10:48331546-48331568 CTGTGCAAACAGCTGAACAGGGG - Intronic
1069630328 10:69893678-69893700 CAGTGGAAACAGCTGGACCTTGG + Intronic
1070586301 10:77769359-77769381 CTGTGCACTCAGCTTTAGCAGGG - Intergenic
1070630566 10:78081777-78081799 CTGTGTAGAGAGCGGGAGCAAGG + Intergenic
1070829625 10:79410546-79410568 CTGTGCAAAGGGCTAGACCACGG + Intronic
1073628036 10:105119546-105119568 CTGTGAAAACAGTTGGAACGGGG + Intronic
1074466042 10:113681532-113681554 CTGTCCAAACAGCAGAACCAAGG - Intronic
1075544413 10:123343547-123343569 CTCTGGAAACAGATGGAGCTGGG + Intergenic
1075925432 10:126248052-126248074 CTGTGCCACCAGCAGGTGCAGGG - Intronic
1076742322 10:132492735-132492757 CAGTGGGAACAGCTGGAGCCAGG - Intergenic
1076992134 11:280926-280948 CTGCGCCAGCAGCTGGAGCTCGG + Exonic
1077418108 11:2435310-2435332 CTGTGCAAATAACTGGACGAAGG + Intergenic
1077871774 11:6268966-6268988 CTGAGAAACCAGCTTGAGCAGGG + Intronic
1078068454 11:8093262-8093284 CAGTGCAGGCAGCAGGAGCAAGG + Intronic
1079081393 11:17415723-17415745 CTGCACAAACAGCTGGGGCAAGG + Intronic
1079087585 11:17457849-17457871 CTGTGCCAACTGCTGCAGGATGG + Intronic
1079119639 11:17672642-17672664 GTGTGCAGACAGCTGTAGTACGG - Intergenic
1079291495 11:19192120-19192142 CTGGGCAAGCAGTTGAAGCAAGG + Intronic
1082787733 11:57326094-57326116 CTGTTCAAGTTGCTGGAGCAGGG - Exonic
1083121820 11:60520678-60520700 CTGTGAAAACAGCCAGATCAGGG - Intronic
1083200668 11:61119240-61119262 CTGTGCCACCAGCTGCAGCCTGG - Exonic
1084088013 11:66863594-66863616 CTCTGAAAACAGCTGGAGTCTGG + Intronic
1084403713 11:68959414-68959436 CCCTGCACACAGCGGGAGCAGGG + Intergenic
1087013977 11:93538590-93538612 CTCTGCTAACAGCTAGAGAAAGG - Intronic
1088512214 11:110589422-110589444 CTGGGCACTCAGCTGGAGTAGGG + Intronic
1089073498 11:115718592-115718614 CTGGGCTGACAGCTGGAGCCAGG + Intergenic
1090254184 11:125271768-125271790 CTGGGCTATGAGCTGGAGCAAGG - Intronic
1090851665 11:130576043-130576065 GTGTGAAAACAGCTGGCACAGGG - Intergenic
1091408296 12:222531-222553 CTGTGCACACAGCTGGTGTGAGG + Exonic
1091604455 12:1938054-1938076 CTCTCCCAACAACTGGAGCATGG + Intergenic
1092029877 12:5275276-5275298 CTGTGCCACAGGCTGGAGCAGGG - Intergenic
1097122959 12:56750073-56750095 CAGTGGAAACAGCTTGAGCAAGG + Intronic
1097330288 12:58325471-58325493 CTGTGCAGATAGCTTGAGCTAGG + Intergenic
1098051737 12:66461505-66461527 CAATGCAAACAGCTGTAGGAAGG - Intronic
1098162544 12:67659117-67659139 CTGTGCATGGACCTGGAGCATGG - Exonic
1102784448 12:115592826-115592848 GTGGGCAAACAGCTGGAGGATGG - Intergenic
1103331353 12:120156449-120156471 CTGAGCACACACCCGGAGCACGG + Exonic
1104559964 12:129834545-129834567 CAGTGCTAGCAGCTGGTGCATGG - Intronic
1104743501 12:131195540-131195562 CTGTGTTTACAGCTGGATCACGG - Intergenic
1104790832 12:131481144-131481166 CTGTGTTTACAGCTGGATCACGG + Intergenic
1105207968 13:18238895-18238917 CTCTGCAAGCAGCTGGATGAAGG + Intergenic
1105210117 13:18252648-18252670 CAGTTCCAACACCTGGAGCAGGG - Intergenic
1105444363 13:20439903-20439925 CTGAGAAAACAGCGGAAGCAGGG + Intronic
1105890333 13:24678014-24678036 CTGTCCCAATAGTTGGAGCAGGG + Intergenic
1106013508 13:25846843-25846865 TTGTGCAACCAGGTGGAGAAGGG - Intronic
1108555178 13:51584612-51584634 CTGAGGAGACTGCTGGAGCACGG - Exonic
1110391322 13:74978087-74978109 CTATTCACACAGCTGTAGCAAGG + Intergenic
1113984555 13:114303452-114303474 CTGTATACACAGATGGAGCATGG - Intronic
1114327861 14:21607431-21607453 CTGAGCAAAGAGTTGAAGCAAGG + Intergenic
1114713785 14:24804174-24804196 CTGTGGAAACAGCAGAAGGAAGG - Intergenic
1115085741 14:29512993-29513015 CTGTGAAAGCAGCTGGAGGGAGG - Intergenic
1119520906 14:75284420-75284442 CTGTGCAATAAGCTAGAGCAAGG - Intergenic
1123008524 14:105335950-105335972 CTGTGCAGGCACCTGGAGCCTGG + Intronic
1123136327 14:106030836-106030858 AAGTGCCAAAAGCTGGAGCAGGG - Intergenic
1124251739 15:28110804-28110826 CTGTGCAGACAGATGGGGCTGGG + Intergenic
1125442063 15:39713821-39713843 CAGTGAAAACAGCTGGAGCCAGG + Intronic
1126942397 15:53780941-53780963 CTGTGAAAGCAGCTGGAAGAAGG - Intergenic
1128572259 15:68742374-68742396 CTGTGCAAGCTGCTGGAGGAAGG - Intergenic
1128673593 15:69593159-69593181 CTGTTCCAACAGCTGCAGCCAGG + Intergenic
1129685901 15:77686026-77686048 ATTTGGAAGCAGCTGGAGCATGG + Intronic
1130416674 15:83701073-83701095 CTCTGCAAACAGGAGAAGCAGGG - Intronic
1130438564 15:83927051-83927073 CTCTGCAAAATACTGGAGCATGG - Intronic
1131522483 15:93126900-93126922 CAGTGGACACAGCTGGAGCAGGG + Intergenic
1132665918 16:1081270-1081292 CTGGGCAGACGGCGGGAGCACGG - Intergenic
1133288345 16:4701786-4701808 CTATGGAAACAGCTGCTGCACGG + Intronic
1135109333 16:19678446-19678468 CAGTGCCAACAGCTGAAGTAAGG - Intronic
1135112289 16:19699627-19699649 CTGTGCAGACACCAGGACCATGG + Exonic
1135598231 16:23759791-23759813 ATGTGCAAAGCCCTGGAGCAAGG - Intergenic
1137392045 16:48089548-48089570 CTGTGTAAACAGCTGGAAATAGG + Intronic
1138211375 16:55166057-55166079 CTATGCAGACAGCTGGGGGAAGG - Intergenic
1140094626 16:71864292-71864314 CTGTTTAAAAAGCTGGGGCAGGG - Intronic
1142118664 16:88375031-88375053 CTGTGCACACAGCTGGGGCAGGG + Intergenic
1146450648 17:32971430-32971452 CTGTGCAAACAGCTGAATGGGGG + Intronic
1147874328 17:43610303-43610325 CTGTGCAAGCTGCTGGAGGACGG - Intergenic
1148236338 17:45971729-45971751 CTGTGGAAACAGCTGGAACACGG - Intronic
1150005009 17:61463895-61463917 GTGGGCCAACAGCTGAAGCAGGG - Intronic
1150333339 17:64312053-64312075 CTTTGCACACAGCAGGATCATGG - Intergenic
1150650740 17:67008464-67008486 CTGGGCAAAGAGCTGAGGCATGG + Intronic
1151665539 17:75543316-75543338 CGGCCCAAACAGGTGGAGCAGGG - Intronic
1151821052 17:76497157-76497179 CTGTGCCAGCAGGTGGTGCAGGG - Intronic
1152451520 17:80384261-80384283 CTGTCCACAATGCTGGAGCATGG + Intronic
1152500731 17:80707212-80707234 TTCTGAAAACATCTGGAGCATGG - Intronic
1152591792 17:81217183-81217205 GTGGGCACACAGCTGGGGCAAGG + Intronic
1155341611 18:24819352-24819374 CAGTGCAAACAGCCCGTGCAGGG + Intergenic
1157989070 18:52473565-52473587 CTTTTCACACAGCTGGAGAAAGG + Intronic
1158970772 18:62664298-62664320 CTCTGCAAAATGCTTGAGCAAGG - Intergenic
1160171261 18:76557370-76557392 AGGTGGAAACAGCTGAAGCATGG - Intergenic
1161217758 19:3102976-3102998 CAGTGCACACACCGGGAGCAAGG - Intronic
1164131556 19:22367446-22367468 CTGGGCACACAGCTAGAGGAAGG + Intergenic
1164424057 19:28124528-28124550 CTGTCCAGACAGATGCAGCAAGG - Intergenic
1164470216 19:28523630-28523652 CTGTGCAAACAGTTGATGTATGG + Intergenic
1165279247 19:34782650-34782672 CTGTCCTCACAGCTGGAGCATGG - Intergenic
1165708548 19:37993268-37993290 CTGTGCCAAGAGCTGGTTCAAGG - Intronic
1167758072 19:51425912-51425934 CTCTGCAGATGGCTGGAGCAAGG - Intergenic
926611706 2:14954208-14954230 CTGGGAAAACACCTGGAACATGG - Intergenic
926811071 2:16755873-16755895 CTATGCAAACAGCTGAAGATGGG + Intergenic
927339499 2:21966331-21966353 CTGAGCAAGCAGCAGGAACAAGG + Intergenic
927962740 2:27250810-27250832 CTGTGTAAAGAGCTGGGGCTGGG + Intergenic
928495586 2:31828657-31828679 CTGTGGACACACCTGGAGCCTGG - Intergenic
930811224 2:55543680-55543702 CTGTACAAACAGCAGAAGCATGG + Intronic
931116927 2:59175019-59175041 TGGTGCAGCCAGCTGGAGCAGGG - Intergenic
931431768 2:62214224-62214246 CTGTGGGAACAGCATGAGCAGGG + Intronic
935639862 2:105280471-105280493 CTCTGCATACAGTTTGAGCAAGG + Exonic
936073878 2:109389291-109389313 CTGTGCAAACAGGAGGAAGAGGG + Intronic
937254612 2:120546368-120546390 CAGTGCAGACATCTGGAGCCAGG - Intergenic
937280256 2:120712793-120712815 CTGTGCCAACACCTGGAGCCAGG + Intergenic
943367785 2:186982053-186982075 CTGTGGCTGCAGCTGGAGCAAGG - Intergenic
944895733 2:204162179-204162201 CTGTAAAAACATCTGGATCAGGG - Intergenic
945357918 2:208860666-208860688 CTGTGAAAGCAGCTGGATTAGGG + Intergenic
946469074 2:219939787-219939809 CTATGCAAAAACCTGGTGCAGGG + Intergenic
948272276 2:236683756-236683778 CTGGGCAAGCATCAGGAGCAGGG - Intergenic
1169014346 20:2279613-2279635 CTGGGCCTACAGCTGCAGCATGG - Intergenic
1169210780 20:3765246-3765268 CTGTGGACACAGCTGCAGCAGGG - Intronic
1169343546 20:4813366-4813388 CTGTGCAGACAGCTTGGGCAGGG - Intronic
1169666449 20:8041876-8041898 CTGTGGAAACAGCAGGGACATGG - Intergenic
1170474568 20:16702016-16702038 CTGTGCAAACAGCCAGATCAAGG + Intergenic
1170498526 20:16950686-16950708 CTGTGCCACCAGCTGATGCAGGG - Intergenic
1170838929 20:19908105-19908127 CCCTGCAGACAGATGGAGCATGG - Intronic
1170853216 20:20022916-20022938 CTGTGGCAACATCTGGAACAAGG - Intronic
1174116560 20:48230444-48230466 CTGTGCAAACAGCCTGATGATGG - Intergenic
1174289562 20:49498244-49498266 CTGTGGAAATAGCAGGAGCAAGG - Intergenic
1175159006 20:56994231-56994253 CTGGGCAAACATCAGCAGCAAGG + Intergenic
1177274763 21:18895764-18895786 CTCTGAATCCAGCTGGAGCAGGG - Intergenic
1178375036 21:32059628-32059650 GTGTGCAAAGAGCTGAAGGACGG + Intergenic
1179064648 21:38013741-38013763 CTCTGCACACAGCTGGGGCATGG - Intronic
1180758533 22:18180780-18180802 CTCTGCAAGCAGCTGGATGAAGG + Intergenic
1180766140 22:18346756-18346778 CAGTTCCAACACCTGGAGCAGGG + Intergenic
1180768820 22:18364572-18364594 CTCTGCAAGCAGCTGGATGAAGG + Intergenic
1180777492 22:18497823-18497845 CTCTGCAAGCAGCTGGATGAAGG - Intergenic
1180780173 22:18515622-18515644 CAGTTCCAACACCTGGAGCAGGG - Intergenic
1180810214 22:18755133-18755155 CTCTGCAAGCAGCTGGATGAAGG - Intergenic
1180812889 22:18772943-18772965 CAGTTCCAACACCTGGAGCAGGG - Intergenic
1180826695 22:18867796-18867818 CTCTGCAAGCAGCTGGATGAAGG + Intergenic
1181196356 22:21189385-21189407 CTCTGCAAGCAGCTGGATGAAGG - Intergenic
1181199067 22:21207259-21207281 CAGTTCCAACACCTGGAGCAGGG - Intergenic
1181213171 22:21303739-21303761 CTCTGCAAGCAGCTGGATGAAGG + Intergenic
1183778509 22:39983676-39983698 TTGTGCAGCCAGCAGGAGCAGGG - Intergenic
1183987395 22:41577081-41577103 CTGGGCCACCAGGTGGAGCATGG + Exonic
1184747255 22:46463594-46463616 CGGGGAAAACAGCTGGAGGATGG - Intronic
1185420630 22:50732424-50732446 CTGGGCAAACAGCTGGACCCAGG - Intergenic
1203227758 22_KI270731v1_random:87647-87669 CAGTTCCAACACCTGGAGCAGGG + Intergenic
1203230442 22_KI270731v1_random:105456-105478 CTCTGCAAGCAGCTGGATGAAGG + Intergenic
1203276838 22_KI270734v1_random:93706-93728 CTCTGCAAGCAGCTGGATGAAGG + Intergenic
949764692 3:7513222-7513244 CTGTGAAAACACCAGGAGAAAGG - Intronic
950236611 3:11327055-11327077 CTCTGCAAAGATCTTGAGCAGGG - Intronic
950658493 3:14452134-14452156 CTGTGAAAACAGAGGGAGGAAGG - Intronic
950713673 3:14832288-14832310 CTGTGACAACACCTGGTGCAGGG - Intronic
951177527 3:19618902-19618924 CTGTGAAAGCAGCTGGGACAGGG - Intergenic
951340082 3:21474927-21474949 CTGTACAAACAGCTAGAGAAAGG - Intronic
952062327 3:29525459-29525481 CTGTGCAAACAGCTTGATGGAGG - Intronic
953793909 3:45968287-45968309 CTGTGCCAAGGGCTGCAGCATGG + Exonic
954438013 3:50506109-50506131 CTGTGCAAACCCCGGGAGCTGGG - Intergenic
954701925 3:52455141-52455163 CTGTGCTTACCGCCGGAGCAGGG - Intronic
954869953 3:53760260-53760282 CTGTCCTAACAGCTGGAGTAGGG - Intronic
955321512 3:57977912-57977934 TTGTGTAAAAAGGTGGAGCAAGG - Intergenic
955614078 3:60787275-60787297 ATGTGTAAAAAGCTGGAGCAGGG - Intronic
956731928 3:72204190-72204212 CTGTGGAAACAGCCTGAGCTGGG - Intergenic
961107174 3:124251891-124251913 CATTGCAAACACCTGGAACAGGG - Intronic
962811636 3:138963370-138963392 CTGTGTAAACAGGAGGCGCATGG - Intergenic
963306197 3:143656007-143656029 ATGAGAAAACTGCTGGAGCAAGG + Intronic
964198036 3:154087263-154087285 CTATGCCAACAGCTAGACCATGG - Intergenic
966863549 3:184243805-184243827 GAGGGCAAACAGCAGGAGCAGGG + Exonic
967564432 3:190957445-190957467 CTGTGCCTACAGCTTGAGAAAGG + Intergenic
967887503 3:194343070-194343092 CTGTGCAAAGAGCAGGTGCCAGG - Intronic
969282721 4:6181938-6181960 CTGTGCAGACAGGAGGAGGAGGG + Intronic
969543279 4:7807423-7807445 CAGAGGAAACAGCTGTAGCACGG - Intronic
969677327 4:8621314-8621336 GTGTGGAAACAGCAGGCGCAAGG + Intergenic
969678282 4:8626952-8626974 GTGTGGAAACAGCAGGCGCAAGG + Intergenic
969679238 4:8632590-8632612 GTGTGGAAACAGCAGGCGCAAGG + Intergenic
970276411 4:14405750-14405772 CTGTGGAAAGAGCTGGCACATGG + Intergenic
970486703 4:16531912-16531934 CAGTTCAAACAGATGGAGGAAGG + Intronic
970518972 4:16863546-16863568 CTCTGCAAGGAGCTGGAGCCAGG + Intronic
972237059 4:37146879-37146901 CTGTGAAAGCAGCTGGGCCAGGG + Intergenic
972628627 4:40824345-40824367 CTGTGGAAACAGCTGGCAAAAGG - Intronic
972772051 4:42206555-42206577 GTCTGCAGACAGCAGGAGCATGG + Intergenic
974391446 4:61275148-61275170 CTGTTCATACAACTGGAACAAGG + Intronic
975174423 4:71270992-71271014 CTGTCCAAAAAGCTATAGCAGGG - Intronic
976206105 4:82624919-82624941 ATGTGCACACAGCTGCACCATGG - Intergenic
976560762 4:86497850-86497872 CTGTGCAAATATTAGGAGCAGGG + Intronic
976999109 4:91473316-91473338 CTGTGCAAAGAGCTGCTTCATGG - Intronic
977014034 4:91670161-91670183 CTGTGAAAGCAGCTGGAAGAAGG - Intergenic
978013864 4:103720129-103720151 CGCTGCAAGCAGCTGGAGCTTGG + Intergenic
978068472 4:104436101-104436123 CTAAGCTAAGAGCTGGAGCATGG - Intergenic
978281716 4:107024691-107024713 CTTTGCAAAGAGATGGAGAAAGG + Intronic
978482542 4:109210741-109210763 CAGGGGAAACAGCTGGAACATGG - Intronic
981594020 4:146398905-146398927 CTGTGTAAGCAGCAGGAGAACGG + Intronic
984162876 4:176275531-176275553 CTGTGTAAACTGCTGGAGAAAGG - Intronic
985549443 5:525529-525551 CCGTCCAAACAGAGGGAGCAGGG - Intergenic
985788285 5:1911326-1911348 CTGTCTAAACAGCCTGAGCAGGG - Intergenic
986134246 5:4959402-4959424 CTGTGCAATAAGCAGGAGTAAGG - Intergenic
986269318 5:6217492-6217514 CAGTGCATACAGCGGGTGCATGG - Intergenic
987286720 5:16465111-16465133 CTGTTCAAACCACTGGAGCCGGG + Exonic
987585048 5:19843708-19843730 CTGTGAAAGCAGCCAGAGCAGGG + Intronic
989243284 5:39224344-39224366 CTGTGAAAACAGATGGGGGAGGG + Intronic
990415789 5:55585271-55585293 CTGTGCAAGAAGCAGGTGCAGGG + Intergenic
994983683 5:106907764-106907786 CCATGCAAACAGCTAGTGCAAGG + Intergenic
996839849 5:127836323-127836345 CTATGAAAGCAGCTGGGGCAGGG - Intergenic
997525589 5:134551050-134551072 TTATGCAAACAGCTGGGGGACGG - Intronic
997597536 5:135117091-135117113 CTGGGCACACAGCTGGTGCCTGG - Intronic
997786083 5:136715279-136715301 CTGTGAAAACAGCTGCACCTGGG - Intergenic
999657964 5:153828995-153829017 GTGTGCAAATAGCTGCAGAAAGG - Intergenic
999693490 5:154168573-154168595 CTCTGCAAACAGCTGAATCTTGG + Intronic
1002000403 5:176193698-176193720 CTGTGCTGACAGCGGGTGCAGGG - Intergenic
1004427600 6:15516951-15516973 CTGACCAAACACCTGGAACATGG - Intronic
1006047125 6:31307822-31307844 CTGCTCAGACACCTGGAGCATGG - Intronic
1006397870 6:33798752-33798774 CTGTGCAAACAGCTGGAGCAAGG - Intronic
1007665959 6:43513072-43513094 CAGTGCCAACATCTGCAGCATGG + Exonic
1007761032 6:44133871-44133893 CTGTGCAAATAACTGGAGAGAGG + Intronic
1010391436 6:75342780-75342802 CTGTGGAAATAGCTGAGGCAGGG - Intronic
1010722175 6:79295876-79295898 CTGTGAAACCATCTGGTGCAGGG + Intergenic
1011805865 6:91071992-91072014 CTGTGAAAGTAGCTGGGGCAAGG + Intergenic
1011809194 6:91110611-91110633 CTGTGTTAACAGGTAGAGCATGG - Intergenic
1011933096 6:92738286-92738308 CTGTGAAAGCAGCTGGAATAGGG + Intergenic
1012747035 6:103104692-103104714 CTGAGAAAACAACTGGAACATGG - Intergenic
1015592941 6:134839834-134839856 CTGAGACAACAGCTGGGGCATGG + Intergenic
1015969557 6:138730556-138730578 CTGTGAAAGCAACTGGAGGAAGG - Intergenic
1016166061 6:140945122-140945144 CTGTGAAAGCAGCAGGAGGAAGG + Intergenic
1016256242 6:142109113-142109135 CTATGAAAACAGCTGAAGCAGGG - Intergenic
1016841397 6:148529110-148529132 CTGTGAAAACAGATGAAGCTTGG + Intronic
1018770520 6:166966840-166966862 CTGTGCATCCATCTGGACCAGGG + Intergenic
1019694414 7:2437172-2437194 GTGTGGACACAGCTGGAGGATGG - Intergenic
1019923940 7:4180176-4180198 CTGGGCATAGAGCTGGAGCTGGG - Intronic
1019923946 7:4180201-4180223 CTGGGCATAGAGCTGGAGCCGGG - Intronic
1019923951 7:4180226-4180248 CTGGGCATAGAGCTGGAGCTGGG - Intronic
1019923957 7:4180251-4180273 CTGGGCATAGAGCTGGAGCCGGG - Intronic
1019923968 7:4180301-4180323 CTGGGCATAGAGCTGGAGCCAGG - Intronic
1019923973 7:4180326-4180348 CTGGGCATAGAGCTGGAGCCGGG - Intronic
1019923979 7:4180351-4180373 CTGGGCATAGAGCTGGAGCCGGG - Intronic
1019923985 7:4180376-4180398 CTGGGCATAGAGCTGGAGCCAGG - Intronic
1019923990 7:4180401-4180423 CTGGGCATAGAGCTGGAGCCAGG - Intronic
1019923994 7:4180426-4180448 CTGGGCATAGAGCTGGAGCTGGG - Intronic
1019924006 7:4180476-4180498 CTGGGCATAGAGCTGGAGCCAGG - Intronic
1019924015 7:4180526-4180548 CTGGGCATAGAGCTGGAGCCGGG - Intronic
1020001250 7:4757206-4757228 CTTTCCTAACAGCTGGAGGACGG - Intronic
1021942314 7:25689802-25689824 GTGGGCAAACAGCTGGAGGATGG - Intergenic
1022494735 7:30845734-30845756 CTGTGAAAGCAGATGGAGGATGG + Intronic
1023431318 7:40094343-40094365 CTGAGCAAGCAGCTGTAACAGGG - Exonic
1024448388 7:49509441-49509463 CTATGGAAACAGCTGTTGCAGGG - Intergenic
1025022263 7:55489014-55489036 CTGAGCAGACAGCTGCAGCAGGG + Intronic
1027220370 7:76210168-76210190 CTGTGCCATCAGCTGGAGATTGG - Intronic
1029629212 7:101739916-101739938 CTGTGCAAACAGACTGAGGAAGG - Intergenic
1029714737 7:102319806-102319828 CTGTGGGAACAGCTGGAACAGGG - Intronic
1031329290 7:120443997-120444019 CTAAGGAAACAGCAGGAGCAAGG - Intronic
1032957420 7:136987201-136987223 CTGTGCTATGTGCTGGAGCAGGG - Intronic
1032978635 7:137254875-137254897 CTGTGGATACTGCTGAAGCAGGG - Exonic
1034590283 7:152132532-152132554 CTGGGCACTGAGCTGGAGCACGG + Intergenic
1035460116 7:159033352-159033374 CTGTGCACAGAGCTGTACCATGG - Intronic
1038441410 8:27573184-27573206 CTGTGAGAACAGCTGGAGTGGGG + Intergenic
1039119043 8:34125365-34125387 CTGGCCAAACACCTGGAGAAAGG - Intergenic
1039309279 8:36298005-36298027 CTGTGAAAACAGCCGGAGTGGGG + Intergenic
1039978000 8:42383495-42383517 CTGTGCAATGTGCTGGTGCAGGG + Intergenic
1042791722 8:72615105-72615127 CTGTCCAGAAAGCAGGAGCATGG + Intronic
1043285559 8:78525151-78525173 CTGGGTAAACAGATGGTGCATGG - Intronic
1045519026 8:102887098-102887120 CTGTGGCAGCAGCTGGAGGAAGG - Intronic
1046932491 8:119855620-119855642 CTGTGCCAGCAGCTGGAGGATGG - Exonic
1047258722 8:123236969-123236991 GCGGGCAAACAGCTGGAGGATGG + Intronic
1048549335 8:135419527-135419549 CTTTGCAATCAGCTGGAGCTAGG + Intergenic
1049030668 8:140035042-140035064 CTGTATACACAGCTGGAGGAGGG + Intronic
1049204577 8:141357804-141357826 CCGGGCAAACAGGTGGAACAGGG + Exonic
1049612546 8:143562197-143562219 CCGTGCCCACAGCTGGAGCAGGG + Exonic
1049671358 8:143871488-143871510 CTGTACGAGCGGCTGGAGCATGG - Exonic
1051309852 9:15758180-15758202 CCTTGAAAACAGCTGGAGGAAGG + Intronic
1051657498 9:19396993-19397015 CTGGGCATATAGCTGGAGCTAGG + Intergenic
1051990332 9:23145252-23145274 CCGTGAAAGCAGCTGGGGCAGGG - Intergenic
1057350465 9:94292997-94293019 CTCATCGAACAGCTGGAGCAAGG + Exonic
1059283098 9:113151204-113151226 CATTGCCAACAGCTGGAACAGGG + Intronic
1059452333 9:114378158-114378180 GTGTGCACATAGCAGGAGCAGGG - Intronic
1060110989 9:120906050-120906072 CTGGGGAAACAGGTGGGGCAGGG - Intronic
1060766614 9:126298718-126298740 CAGTAGAAACAGCTGGAGCAAGG - Intergenic
1060941137 9:127543462-127543484 CTGTGGAAACATCTGGAAGATGG + Intronic
1061041382 9:128142753-128142775 CTGTGTAGACAGCTGCAGCTGGG - Intergenic
1061923880 9:133796674-133796696 CTCTGCACACACCTGGTGCATGG - Intronic
1062199417 9:135293823-135293845 CTGTACAAACAGCTGGATGGGGG + Intergenic
1062530244 9:136996511-136996533 CTTGACAAACAGCTGGAGCTTGG + Exonic
1188286811 X:28336558-28336580 CTGTAAAAGCTGCTGGAGCAGGG + Intergenic
1188734044 X:33690367-33690389 CTGTGGAAACTGTTGAAGCATGG - Intergenic
1189840630 X:45072618-45072640 CTGCTCTAACTGCTGGAGCAGGG + Intronic
1190320124 X:49175156-49175178 GAGTGGAAACAGCTGGGGCAAGG + Exonic
1190584394 X:51923782-51923804 CTGGGCAAACAGCTGGCGAGTGG - Intergenic
1191693479 X:63964428-63964450 CTGTGTAAATAGCTGAAGGAAGG - Intergenic
1193551098 X:82893599-82893621 CTGTGCAGAGATCTGGTGCAGGG + Intergenic
1195107690 X:101616661-101616683 CTCTTCAATCAGGTGGAGCAAGG - Exonic
1195457408 X:105084327-105084349 CTGTGAAAACAGCTGGGGACCGG + Intronic
1195596272 X:106693781-106693803 CTGTGTGTACAGCTGGAGGAGGG + Intronic
1197986256 X:132269306-132269328 CAGTGCTAACAACTTGAGCAGGG - Intergenic
1198405102 X:136304569-136304591 CTGTGCTAACTCCTGGGGCAGGG + Intronic
1198426513 X:136526128-136526150 CTGTGCACAGAGTTGGAACATGG + Intergenic
1198912875 X:141633906-141633928 CTGTGAAAACAGCTGGGAGAGGG + Intronic
1199461638 X:148091949-148091971 CTCTGCAAACTACTAGAGCAAGG - Intergenic
1199947806 X:152681844-152681866 CTGCGGAAACAGCAGGGGCAAGG - Intergenic
1199950075 X:152699860-152699882 CTGAGGTAACAGCAGGAGCAGGG - Intronic
1199959599 X:152768601-152768623 CTGAGGTAACAGCAGGAGCAGGG + Intronic
1199961873 X:152786610-152786632 CTGCGGAAACAGCAGGGGCAAGG + Intergenic