ID: 1006399204

View in Genome Browser
Species Human (GRCh38)
Location 6:33806586-33806608
Sequence CAGTTTCCCCACATGTAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006399204_1006399213 29 Left 1006399204 6:33806586-33806608 CCAACTTACATGTGGGGAAACTG No data
Right 1006399213 6:33806638-33806660 GCTATTCAAATGGCCAGGCCAGG No data
1006399204_1006399208 -1 Left 1006399204 6:33806586-33806608 CCAACTTACATGTGGGGAAACTG No data
Right 1006399208 6:33806608-33806630 GAGGTGGAACAACGGACCCAAGG No data
1006399204_1006399211 19 Left 1006399204 6:33806586-33806608 CCAACTTACATGTGGGGAAACTG No data
Right 1006399211 6:33806628-33806650 AGGTCACACAGCTATTCAAATGG No data
1006399204_1006399207 -9 Left 1006399204 6:33806586-33806608 CCAACTTACATGTGGGGAAACTG No data
Right 1006399207 6:33806600-33806622 GGGAAACTGAGGTGGAACAACGG No data
1006399204_1006399212 24 Left 1006399204 6:33806586-33806608 CCAACTTACATGTGGGGAAACTG No data
Right 1006399212 6:33806633-33806655 ACACAGCTATTCAAATGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006399204 Original CRISPR CAGTTTCCCCACATGTAAGT TGG (reversed) Intergenic
No off target data available for this crispr