ID: 1006400095

View in Genome Browser
Species Human (GRCh38)
Location 6:33812780-33812802
Sequence CTCGGCAGTGAGGTTTTCTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006400084_1006400095 28 Left 1006400084 6:33812729-33812751 CCTTATCCGATGTCCCTTCAAGC No data
Right 1006400095 6:33812780-33812802 CTCGGCAGTGAGGTTTTCTTAGG No data
1006400089_1006400095 14 Left 1006400089 6:33812743-33812765 CCTTCAAGCTGCAGTCAAAGGGA No data
Right 1006400095 6:33812780-33812802 CTCGGCAGTGAGGTTTTCTTAGG No data
1006400085_1006400095 22 Left 1006400085 6:33812735-33812757 CCGATGTCCCTTCAAGCTGCAGT No data
Right 1006400095 6:33812780-33812802 CTCGGCAGTGAGGTTTTCTTAGG No data
1006400087_1006400095 15 Left 1006400087 6:33812742-33812764 CCCTTCAAGCTGCAGTCAAAGGG No data
Right 1006400095 6:33812780-33812802 CTCGGCAGTGAGGTTTTCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006400095 Original CRISPR CTCGGCAGTGAGGTTTTCTT AGG Intergenic
No off target data available for this crispr