ID: 1006401042

View in Genome Browser
Species Human (GRCh38)
Location 6:33817560-33817582
Sequence CTTCCTTCCAAGCTGGGACA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006401034_1006401042 -7 Left 1006401034 6:33817544-33817566 CCTTCCTCCTCAACCCCTTCCTT No data
Right 1006401042 6:33817560-33817582 CTTCCTTCCAAGCTGGGACACGG No data
1006401032_1006401042 27 Left 1006401032 6:33817510-33817532 CCATGTCTTCACTGTGGGCACTT No data
Right 1006401042 6:33817560-33817582 CTTCCTTCCAAGCTGGGACACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006401042 Original CRISPR CTTCCTTCCAAGCTGGGACA CGG Intergenic
No off target data available for this crispr