ID: 1006401856

View in Genome Browser
Species Human (GRCh38)
Location 6:33822369-33822391
Sequence ACTGGGGCTCCTCCCCGAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006401851_1006401856 -4 Left 1006401851 6:33822350-33822372 CCCGGAGGTGCTGGGCTGCACTG No data
Right 1006401856 6:33822369-33822391 ACTGGGGCTCCTCCCCGAAGAGG No data
1006401848_1006401856 2 Left 1006401848 6:33822344-33822366 CCCCTTCCCGGAGGTGCTGGGCT No data
Right 1006401856 6:33822369-33822391 ACTGGGGCTCCTCCCCGAAGAGG No data
1006401850_1006401856 0 Left 1006401850 6:33822346-33822368 CCTTCCCGGAGGTGCTGGGCTGC No data
Right 1006401856 6:33822369-33822391 ACTGGGGCTCCTCCCCGAAGAGG No data
1006401849_1006401856 1 Left 1006401849 6:33822345-33822367 CCCTTCCCGGAGGTGCTGGGCTG No data
Right 1006401856 6:33822369-33822391 ACTGGGGCTCCTCCCCGAAGAGG No data
1006401852_1006401856 -5 Left 1006401852 6:33822351-33822373 CCGGAGGTGCTGGGCTGCACTGG No data
Right 1006401856 6:33822369-33822391 ACTGGGGCTCCTCCCCGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006401856 Original CRISPR ACTGGGGCTCCTCCCCGAAG AGG Intergenic
No off target data available for this crispr