ID: 1006402067

View in Genome Browser
Species Human (GRCh38)
Location 6:33823621-33823643
Sequence CTCACGCTGGGGAATTCGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006402067_1006402076 28 Left 1006402067 6:33823621-33823643 CCAGTCGAATTCCCCAGCGTGAG No data
Right 1006402076 6:33823672-33823694 AAGCCAGTGGTTCTCAAAGCTGG No data
1006402067_1006402073 -7 Left 1006402067 6:33823621-33823643 CCAGTCGAATTCCCCAGCGTGAG No data
Right 1006402073 6:33823637-33823659 GCGTGAGCCTAGGAAGAGCTGGG No data
1006402067_1006402072 -8 Left 1006402067 6:33823621-33823643 CCAGTCGAATTCCCCAGCGTGAG No data
Right 1006402072 6:33823636-33823658 AGCGTGAGCCTAGGAAGAGCTGG No data
1006402067_1006402075 15 Left 1006402067 6:33823621-33823643 CCAGTCGAATTCCCCAGCGTGAG No data
Right 1006402075 6:33823659-33823681 GAATGTTTTCTCTAAGCCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006402067 Original CRISPR CTCACGCTGGGGAATTCGAC TGG (reversed) Intergenic
No off target data available for this crispr