ID: 1006402890

View in Genome Browser
Species Human (GRCh38)
Location 6:33828071-33828093
Sequence ACTTTGGCTTCCACTCTGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006402890_1006402895 5 Left 1006402890 6:33828071-33828093 CCACTCAGAGTGGAAGCCAAAGT No data
Right 1006402895 6:33828099-33828121 CCATGGCCCAGAAAGCCCTGTGG No data
1006402890_1006402897 11 Left 1006402890 6:33828071-33828093 CCACTCAGAGTGGAAGCCAAAGT No data
Right 1006402897 6:33828105-33828127 CCCAGAAAGCCCTGTGGAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006402890 Original CRISPR ACTTTGGCTTCCACTCTGAG TGG (reversed) Intergenic
No off target data available for this crispr