ID: 1006405101

View in Genome Browser
Species Human (GRCh38)
Location 6:33840479-33840501
Sequence CTACCTCATTGGGTTGCTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006405097_1006405101 6 Left 1006405097 6:33840450-33840472 CCTGGGACCTTTCAGCTTGGCTC No data
Right 1006405101 6:33840479-33840501 CTACCTCATTGGGTTGCTCAAGG No data
1006405098_1006405101 -1 Left 1006405098 6:33840457-33840479 CCTTTCAGCTTGGCTCACTCTGC No data
Right 1006405101 6:33840479-33840501 CTACCTCATTGGGTTGCTCAAGG No data
1006405095_1006405101 16 Left 1006405095 6:33840440-33840462 CCTGAGGTTACCTGGGACCTTTC No data
Right 1006405101 6:33840479-33840501 CTACCTCATTGGGTTGCTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006405101 Original CRISPR CTACCTCATTGGGTTGCTCA AGG Intergenic