ID: 1006407476

View in Genome Browser
Species Human (GRCh38)
Location 6:33853557-33853579
Sequence CTGAGTGAGTGGTGGGTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006407464_1006407476 27 Left 1006407464 6:33853507-33853529 CCAAGCTTTTCACACGTAGCTGC No data
Right 1006407476 6:33853557-33853579 CTGAGTGAGTGGTGGGTGCAGGG No data
1006407470_1006407476 -8 Left 1006407470 6:33853542-33853564 CCAAGCACAGGGGACCTGAGTGA No data
Right 1006407476 6:33853557-33853579 CTGAGTGAGTGGTGGGTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006407476 Original CRISPR CTGAGTGAGTGGTGGGTGCA GGG Intergenic
No off target data available for this crispr