ID: 1006408010

View in Genome Browser
Species Human (GRCh38)
Location 6:33856351-33856373
Sequence GGTGGGAGTCACTCTTGGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006408010_1006408015 10 Left 1006408010 6:33856351-33856373 CCTCTCCAAGAGTGACTCCCACC No data
Right 1006408015 6:33856384-33856406 TGACCAGACCAGAAACCCGCAGG No data
1006408010_1006408018 19 Left 1006408010 6:33856351-33856373 CCTCTCCAAGAGTGACTCCCACC No data
Right 1006408018 6:33856393-33856415 CAGAAACCCGCAGGAAGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006408010 Original CRISPR GGTGGGAGTCACTCTTGGAG AGG (reversed) Intergenic
No off target data available for this crispr