ID: 1006410912

View in Genome Browser
Species Human (GRCh38)
Location 6:33872743-33872765
Sequence CAGCCCCCACCTGTGGGCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006410912_1006410919 -1 Left 1006410912 6:33872743-33872765 CCAAGGCCCACAGGTGGGGGCTG No data
Right 1006410919 6:33872765-33872787 GGGGAGGATGTGTTCTTAACAGG No data
1006410912_1006410920 4 Left 1006410912 6:33872743-33872765 CCAAGGCCCACAGGTGGGGGCTG No data
Right 1006410920 6:33872770-33872792 GGATGTGTTCTTAACAGGCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006410912 Original CRISPR CAGCCCCCACCTGTGGGCCT TGG (reversed) Intergenic
No off target data available for this crispr