ID: 1006411016

View in Genome Browser
Species Human (GRCh38)
Location 6:33873182-33873204
Sequence CCGGGAGCCCAGGAAGATCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006411002_1006411016 16 Left 1006411002 6:33873143-33873165 CCTCCCACATCTCCCAAAGATCA No data
Right 1006411016 6:33873182-33873204 CCGGGAGCCCAGGAAGATCAAGG No data
1006411004_1006411016 12 Left 1006411004 6:33873147-33873169 CCACATCTCCCAAAGATCAGCCC No data
Right 1006411016 6:33873182-33873204 CCGGGAGCCCAGGAAGATCAAGG No data
1006411006_1006411016 3 Left 1006411006 6:33873156-33873178 CCAAAGATCAGCCCTCCTCAGTG No data
Right 1006411016 6:33873182-33873204 CCGGGAGCCCAGGAAGATCAAGG No data
1006411000_1006411016 28 Left 1006411000 6:33873131-33873153 CCAGTGCTCCATCCTCCCACATC No data
Right 1006411016 6:33873182-33873204 CCGGGAGCCCAGGAAGATCAAGG No data
1006411009_1006411016 -8 Left 1006411009 6:33873167-33873189 CCCTCCTCAGTGACCCCGGGAGC No data
Right 1006411016 6:33873182-33873204 CCGGGAGCCCAGGAAGATCAAGG No data
1006411010_1006411016 -9 Left 1006411010 6:33873168-33873190 CCTCCTCAGTGACCCCGGGAGCC No data
Right 1006411016 6:33873182-33873204 CCGGGAGCCCAGGAAGATCAAGG No data
1006411001_1006411016 20 Left 1006411001 6:33873139-33873161 CCATCCTCCCACATCTCCCAAAG No data
Right 1006411016 6:33873182-33873204 CCGGGAGCCCAGGAAGATCAAGG No data
1006411005_1006411016 4 Left 1006411005 6:33873155-33873177 CCCAAAGATCAGCCCTCCTCAGT No data
Right 1006411016 6:33873182-33873204 CCGGGAGCCCAGGAAGATCAAGG No data
1006411003_1006411016 13 Left 1006411003 6:33873146-33873168 CCCACATCTCCCAAAGATCAGCC No data
Right 1006411016 6:33873182-33873204 CCGGGAGCCCAGGAAGATCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006411016 Original CRISPR CCGGGAGCCCAGGAAGATCA AGG Intergenic
No off target data available for this crispr