ID: 1006411652

View in Genome Browser
Species Human (GRCh38)
Location 6:33877433-33877455
Sequence CTGCATGCACACGCATGCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006411644_1006411652 13 Left 1006411644 6:33877397-33877419 CCATTCCTCAGAACTGCCTTCAG No data
Right 1006411652 6:33877433-33877455 CTGCATGCACACGCATGCAGTGG No data
1006411642_1006411652 29 Left 1006411642 6:33877381-33877403 CCTCTTCTGTCCAGAGCCATTCC No data
Right 1006411652 6:33877433-33877455 CTGCATGCACACGCATGCAGTGG No data
1006411641_1006411652 30 Left 1006411641 6:33877380-33877402 CCCTCTTCTGTCCAGAGCCATTC No data
Right 1006411652 6:33877433-33877455 CTGCATGCACACGCATGCAGTGG No data
1006411648_1006411652 -3 Left 1006411648 6:33877413-33877435 CCTTCAGGAGGCCCTGACCACTG No data
Right 1006411652 6:33877433-33877455 CTGCATGCACACGCATGCAGTGG No data
1006411647_1006411652 8 Left 1006411647 6:33877402-33877424 CCTCAGAACTGCCTTCAGGAGGC No data
Right 1006411652 6:33877433-33877455 CTGCATGCACACGCATGCAGTGG No data
1006411643_1006411652 19 Left 1006411643 6:33877391-33877413 CCAGAGCCATTCCTCAGAACTGC No data
Right 1006411652 6:33877433-33877455 CTGCATGCACACGCATGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006411652 Original CRISPR CTGCATGCACACGCATGCAG TGG Intergenic
No off target data available for this crispr