ID: 1006412219

View in Genome Browser
Species Human (GRCh38)
Location 6:33880710-33880732
Sequence AAATATTTAGGCTAAATTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 687
Summary {0: 158, 1: 96, 2: 33, 3: 40, 4: 360}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006412219_1006412224 -2 Left 1006412219 6:33880710-33880732 CCCACAATTTAGCCTAAATATTT 0: 158
1: 96
2: 33
3: 40
4: 360
Right 1006412224 6:33880731-33880753 TTGTCCTGGGTTGCTTATACTGG No data
1006412219_1006412226 15 Left 1006412219 6:33880710-33880732 CCCACAATTTAGCCTAAATATTT 0: 158
1: 96
2: 33
3: 40
4: 360
Right 1006412226 6:33880748-33880770 TACTGGTCCAAGCAAGCATTAGG 0: 135
1: 98
2: 46
3: 35
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006412219 Original CRISPR AAATATTTAGGCTAAATTGT GGG (reversed) Intergenic
900813646 1:4826928-4826950 AAATATTTAGGCTAAATTGTGGG - Intergenic
901178660 1:7324158-7324180 AGATTTTAAGGCTATATTGTTGG + Intronic
901479168 1:9512473-9512495 AAATATTTAGGCTAAATTGTGGG - Intergenic
902700007 1:18165740-18165762 AAATATTTAGGCTAAATTGTGGG - Intronic
903206764 1:21788232-21788254 AAATATTTAGGCTAAATTGTGGG + Intergenic
903252996 1:22070297-22070319 AAATATTTAGGCTAAATTGTGGG - Intronic
904275469 1:29381303-29381325 AAAAATTTAGGCTACCTTCTTGG + Intergenic
904308431 1:29607178-29607200 AAATATTTTGTCTAATTTGGGGG + Intergenic
905536373 1:38725438-38725460 AAATATTTAGGCTAAATTGTGGG - Intergenic
906883723 1:49621523-49621545 AAATATTTAGGCTAAATTGTGGG + Intronic
907226255 1:52949770-52949792 AAATATTTAGGCTAAATTGTGGG + Intronic
907804813 1:57807666-57807688 AAATTTTTAATATAAATTGTAGG - Intronic
908015098 1:59823916-59823938 AGATATTTAGGGTTAATTTTAGG - Intronic
909197042 1:72640330-72640352 AAATATTTTGGAAAAATTTTGGG + Intergenic
909463751 1:75949055-75949077 AAATATTTAGGCTAAATTGTGGG - Intergenic
909856991 1:80547537-80547559 AAATATTTAGGCTAAATTGTGGG - Intergenic
910266647 1:85344994-85345016 AAATATATATGTTACATTGTTGG - Intronic
910325209 1:85998979-85999001 AAACTGTCAGGCTAAATTGTTGG + Intronic
911032575 1:93505588-93505610 AAATATTTAGGCTAAATTGTGGG + Intronic
911102016 1:94102674-94102696 AAATATTTAGGGACAGTTGTAGG - Intronic
911175820 1:94817016-94817038 AAATATTAAAGCTGTATTGTTGG + Intergenic
911283068 1:95955618-95955640 AAATATTTAGGCTAAATTGTGGG - Intergenic
911325575 1:96467759-96467781 AAATTTATAGGCTTAAGTGTAGG - Intergenic
911635761 1:100233944-100233966 AAATTTTTAGGCTAAATTGTAGG + Intronic
911798568 1:102105562-102105584 CAAGATTTAGTCCAAATTGTAGG - Intergenic
912256968 1:108070053-108070075 AGATATTTATGCTAAATTCAAGG - Intergenic
912338805 1:108889477-108889499 AAATACTTAGGCTAAATTGTGGG + Intronic
912438959 1:109683815-109683837 AAGTATTTAGGCTAAATTGTGGG - Intronic
912441481 1:109702260-109702282 AAGTATTTAGGCTAAATTGTGGG - Intronic
913488575 1:119356929-119356951 AAATATTTAGGCTAAATTGTGGG + Intergenic
913659555 1:120994290-120994312 AAATATTTGGGCAAAATGTTTGG + Intergenic
914166913 1:145183698-145183720 AAATATTTGGGCAAAATGTTTGG - Intergenic
914438071 1:147678201-147678223 AAATATTTAGGCTAACTTGTGGG + Intergenic
914649537 1:149686074-149686096 AAATATTTGGGCAAAATGTTTGG + Intergenic
915591311 1:156872154-156872176 GAATATTTAAGATAATTTGTTGG - Intronic
915820913 1:159022694-159022716 AAATATTTAGGCTAAATTGTGGG + Intronic
916771294 1:167911375-167911397 AAATATTTAGGCTACATTGTGGG - Intronic
916908210 1:169312938-169312960 AAACATCAAGGCTAAATTTTTGG + Intronic
916992274 1:170256957-170256979 AAATATTTAGGCAAATTGGGAGG - Intergenic
917074614 1:171191344-171191366 ACATTTTTAAGCCAAATTGTTGG + Intronic
917237332 1:172908361-172908383 AACTATGTAGGCTTATTTGTGGG - Intergenic
917306979 1:173637416-173637438 AAATACCTATGCTAAAATGTGGG - Intronic
918160915 1:181898659-181898681 AAATATTAATGCTAATTTGAAGG - Intergenic
918518929 1:185393168-185393190 AAATATTTAGTCTTAATTTGGGG - Intergenic
918770168 1:188546736-188546758 ATATATTTAGGTTAAATACTGGG - Intergenic
919199739 1:194340612-194340634 AAAAAATTAGGGTAAATTTTCGG + Intergenic
921744441 1:218723208-218723230 ATATATTGATGCTACATTGTGGG - Intergenic
922238695 1:223740643-223740665 AAATACTTAGGCTAAATTGTGGG + Intronic
922976675 1:229790610-229790632 AAATATTTAGGCTAAATTGTGGG - Intergenic
923309127 1:232718171-232718193 AAATATTTAGGCTAAACTGTGGG + Intergenic
923309230 1:232719443-232719465 AAATATCTAGGCTAAAATGTGGG + Intergenic
923312194 1:232745918-232745940 AAATATTTAGGCTAAACTGCGGG + Intergenic
923330009 1:232914494-232914516 AAATATTTAGGCTAAATTGTGGG + Intergenic
923357746 1:233177207-233177229 AAGTATTTAGGCTAAATTGTGGG - Intronic
923896109 1:238271723-238271745 AAATATTTAGACTAAAAAATGGG + Intergenic
924209443 1:241749428-241749450 ATAAATATAGGATAAATTGTTGG + Intronic
924806979 1:247369244-247369266 AGATATTTAGGCTAAATTGTGGG + Intergenic
924938621 1:248793559-248793581 AGAAATATAGGCTAAACTGTAGG + Intergenic
1063592198 10:7406290-7406312 AAATTTTTAGGCATAAGTGTAGG + Intronic
1063743735 10:8855678-8855700 AAATATTTCTGCTATATTGTTGG + Intergenic
1064291845 10:14042168-14042190 AAATATTTAGGCTACATGGTGGG - Intronic
1064460795 10:15533122-15533144 AAATATTTAAGGAAAATTATTGG - Intronic
1064573053 10:16715403-16715425 AAAATTTTAGGGGAAATTGTAGG - Intronic
1064756220 10:18573755-18573777 AAATATTTAGGCCACTTAGTAGG + Intronic
1064820776 10:19329417-19329439 AAATATTTTGTTTAAATTGGGGG - Intronic
1064847887 10:19676378-19676400 AGATATTTAGGCGAAATTGATGG + Intronic
1066247821 10:33600882-33600904 AAATATTTAGGCTAAATAGTGGG - Intergenic
1066490708 10:35891464-35891486 AAATATTTCTATTAAATTGTTGG + Intergenic
1068135135 10:52945651-52945673 AAATATTTAGGCTAAATTGTGGG - Intergenic
1068138340 10:52973270-52973292 CAGAATTTAGCCTAAATTGTAGG + Intergenic
1068245138 10:54356048-54356070 AAGTATTAAAGCTATATTGTGGG - Intronic
1068299263 10:55117608-55117630 GAATATTGAGTCTAAATAGTGGG - Intronic
1069213652 10:65792603-65792625 AAGTATTCAGGCTAAATTGTGGG + Intergenic
1069450862 10:68516482-68516504 AAATATTTAGGCTAAATTGTGGG + Intronic
1069452747 10:68530256-68530278 AAATATTTAGACTAAATTGTGGG + Intergenic
1071370972 10:84951486-84951508 AAATATTGAAGCAAAATTGTGGG - Intergenic
1071460770 10:85892987-85893009 AAATATTTTAGCTAAAGTATTGG - Intronic
1072814722 10:98494492-98494514 AAATATTTAGGCTAAATTGTGGG + Intronic
1073091045 10:100940008-100940030 TAATATTTAGGGGAAATAGTTGG - Intronic
1073701954 10:105936522-105936544 AACCATTTAGTCTAAAGTGTAGG - Intergenic
1073848401 10:107586306-107586328 AAATATTTAGGCTAAATTGTGGG - Intergenic
1074599249 10:114897073-114897095 AAATATTAAGGCTAAATTGTGGG - Intronic
1074794610 10:116929634-116929656 AAATATTTAGACTAATTTTTTGG - Intronic
1075779637 10:125008835-125008857 AAATATTTAGGCTAAATTGCGGG - Intronic
1076272900 10:129170282-129170304 AAATATTTAGTGTAAAATGCAGG - Intergenic
1076430279 10:130397081-130397103 AAATATTTAGGCTAAATTGTGGG + Intergenic
1076565977 10:131399623-131399645 GAATATTTAAGCTACATTGTGGG + Intergenic
1076654696 10:132015945-132015967 AAATATTTAGGCTAAATTGGGGG + Intergenic
1076656857 10:132029997-132030019 ATGTATTTTGGCAAAATTGTGGG + Intergenic
1077398370 11:2338681-2338703 AAACATTTAGACTAAATTGTGGG - Intergenic
1077748061 11:4930656-4930678 AAATATTAAATCTAAATTTTGGG - Intronic
1078045101 11:7906418-7906440 AAATATTTAGGCTAAATTGTGGG + Intergenic
1078073779 11:8138704-8138726 AAATATTTAGGCTAAACTGTGGG - Intronic
1078221865 11:9357986-9358008 AAATATTTAGGCTAAATTATGGG - Intergenic
1078950651 11:16129222-16129244 ACATATTTAGGCTAAAGTTGAGG - Intronic
1078971387 11:16416379-16416401 AATTATTTATTCTGAATTGTAGG + Intronic
1079923571 11:26462919-26462941 ATATATATAGGCTAAACTCTGGG + Intronic
1080203499 11:29702947-29702969 AAATAAATTGGCTAAATTCTTGG - Intergenic
1080822034 11:35816562-35816584 TAAAATTTAGACTAAATTGTTGG + Exonic
1080962918 11:37181129-37181151 AAATATTTAGGCTAAATTGTGGG + Intergenic
1081778040 11:45690090-45690112 AAATATTTAGGCTAAACTGTGGG - Intergenic
1082862838 11:57872084-57872106 ATATATTTAGGCTGAATTCCTGG + Intergenic
1082941608 11:58711074-58711096 AAATATTTAGGCTAAACTGTGGG - Intronic
1083390066 11:62342312-62342334 AAATATTTAGGCTAAATTGTGGG + Intronic
1083539121 11:63499739-63499761 AAATATTTAGGCTAAATTGTGGG - Intergenic
1084048221 11:66583034-66583056 AAGTATTTAGGCTAAATTGTGGG + Intergenic
1084202910 11:67573940-67573962 CAAGATTTAGTCAAAATTGTAGG - Intergenic
1084214008 11:67637685-67637707 AAATATTTAGGCTAAATTGTGGG + Intronic
1085241319 11:75058690-75058712 AGGTACTTAGACTAAATTGTAGG + Intergenic
1085918450 11:80921499-80921521 AAATATTTAGGCTAAATTGTGGG - Intergenic
1085997059 11:81930774-81930796 AAAGACTCAGGCTTAATTGTAGG - Intergenic
1086154386 11:83649491-83649513 AGATATTTAGGCAAAATTGAAGG + Intronic
1086767955 11:90722814-90722836 AAATATCTAGGCTAAAATATGGG + Intergenic
1087425222 11:97976663-97976685 AAATATTTAGGCTAAATTGTGGG + Intergenic
1088035246 11:105304185-105304207 AAATATCTAGAATAATTTGTAGG + Intergenic
1088102863 11:106174211-106174233 AAATGTTTAGGCTAAATTGTGGG + Intergenic
1089108987 11:116039667-116039689 AAATATGTAGGGTAAAAGGTTGG - Intergenic
1089265474 11:117256958-117256980 AAATATTTAGGATGAGTTGTAGG + Intronic
1089356370 11:117856592-117856614 AACCATTTAGACTAAACTGTGGG - Intronic
1089571270 11:119412105-119412127 AAATATTTAAAGTAAATTATAGG + Intergenic
1090142640 11:124281089-124281111 AAATATTTGGGCTTACTTTTTGG - Intergenic
1090320347 11:125837826-125837848 GAATATTCAGGCTGGATTGTGGG - Intronic
1090818867 11:130322640-130322662 AAATATTTAGGCTAAATTGTGGG + Intergenic
1091097525 11:132838125-132838147 AAATATTCTGGCTAAATGGGAGG + Intronic
1091141221 11:133236645-133236667 AAATATTTAGGCTAAATTGTGGG - Intronic
1091467513 12:698090-698112 AAATATTTAGGCTAAATTGTGGG - Intergenic
1091865460 12:3831759-3831781 AAATATATAAGGTAAATAGTGGG - Intronic
1093076656 12:14765967-14765989 AAATATTTAGGCTAAATTGTGGG - Intergenic
1093957418 12:25236772-25236794 AAATACTTAGGTAAAATTGTTGG + Intronic
1094477152 12:30849934-30849956 AAATATTTAGGCTAAATTGTGGG + Intergenic
1096605145 12:52759812-52759834 AAATAATTAGTCTAAACAGTGGG + Intergenic
1097126485 12:56780398-56780420 AAATATTTAGGTTAAATTGTGGG - Intronic
1098198133 12:68024038-68024060 AATTGCTTAGGCTAAATTTTAGG + Intergenic
1098403607 12:70100316-70100338 AAATATGTAGATTAAAATGTAGG - Intergenic
1098711055 12:73762654-73762676 AAATATTTAGGCTAAATTGTGGG - Intergenic
1098808729 12:75055820-75055842 AAATATTTAAGCAAATTTTTAGG + Intronic
1099450913 12:82805279-82805301 AAATATTTAGGCTAAATTGTGGG + Intronic
1099706836 12:86164946-86164968 ATTCATTTAGGCTAAAATGTAGG + Intronic
1100169240 12:91954738-91954760 AAATATTTAGAGGACATTGTAGG - Intergenic
1100312772 12:93412856-93412878 AAATATTTAGGCTAAATTGTGGG + Intronic
1100419798 12:94421996-94422018 AAATATCTAGGCCAAAAGGTGGG - Intronic
1100620692 12:96269986-96270008 AATTATTGAGGCTGACTTGTGGG + Intergenic
1100695620 12:97089644-97089666 AAATATTTAGAGTCCATTGTAGG + Intergenic
1100954789 12:99894752-99894774 ATATATTTATAATAAATTGTTGG - Intronic
1101176477 12:102156490-102156512 AAATATTTAAGGTTAATTCTGGG - Intronic
1101567717 12:105924163-105924185 ACATAATTAGGCTAAACTTTAGG + Intergenic
1102243521 12:111340705-111340727 AAATATTTAGGCTAAATCGTGGG - Intronic
1102292416 12:111711877-111711899 AAATATTTAGACTAAATTGCAGG - Intronic
1102478776 12:113206263-113206285 AAATATCTAAGCTAAAATGTGGG - Intronic
1103762348 12:123260175-123260197 AAATATTTAGGCTAAATTGTGGG - Intergenic
1104188356 12:126454271-126454293 AAATATTTAGGCTAAATTGTGGG + Intergenic
1104207389 12:126652622-126652644 AAAAATTTTGATTAAATTGTGGG - Intergenic
1105764114 13:23541628-23541650 AAATATTTATGGTACATTATGGG - Intergenic
1106014756 13:25858210-25858232 AAATAGTTACTCAAAATTGTAGG - Intronic
1106341066 13:28827443-28827465 AAATTTTTCTGCTAAATTTTAGG + Intronic
1106386724 13:29293030-29293052 AAATAATTAGTTTAAAATGTGGG + Intronic
1106428928 13:29660604-29660626 AAATATTTAAGCTAAATTGTGGG + Intergenic
1107590620 13:41900187-41900209 AGAGATTTAGGCTAGATAGTTGG + Intronic
1109585740 13:64400734-64400756 AAATATCTAGGCAAAAATTTAGG - Intergenic
1109605286 13:64686617-64686639 AAATATTTAGGCTAAATTGTGGG - Intergenic
1109745175 13:66615081-66615103 AAATATTTAGGCTAAATTGTGGG + Intronic
1109759831 13:66813327-66813349 TAATATTTTGGTTAAATAGTAGG - Intronic
1110025288 13:70530096-70530118 AAAAATTGAGGTTAAATTGAAGG + Intergenic
1110555510 13:76855308-76855330 AAATCCTTATGCTAAAATGTGGG + Intergenic
1111249772 13:85588200-85588222 CAATATTTCAGCTAAATTTTTGG + Intergenic
1111549518 13:89788423-89788445 AAATATTTAGGATGAATTTATGG + Intergenic
1111586473 13:90289749-90289771 AAATATTTAGGCTAAATTGTGGG + Intergenic
1112209085 13:97356202-97356224 GATTATTTAGGCGAAACTGTTGG - Intronic
1112519770 13:100085000-100085022 AAATATTTATGCTAAATTGTGGG + Intergenic
1112533704 13:100229468-100229490 AAATATTTAGGCTAAATTGTGGG - Intronic
1112929481 13:104716067-104716089 GAATATTTAGGCTAAATTGTGGG - Intergenic
1113221658 13:108111232-108111254 AAATATTTGTGGTACATTGTAGG - Intergenic
1113995339 14:16059951-16059973 AAATATTTAGGGTAAAGAATAGG + Intergenic
1114301769 14:21384981-21385003 AATTATTTAAGGTAAATGGTAGG - Intergenic
1114511053 14:23261292-23261314 AAATATTTAGGCTAAATTGTGGG + Intronic
1114784428 14:25580144-25580166 AAATATTTAGGAAAAGTTGGTGG - Intergenic
1114820199 14:26009215-26009237 ATATTTTTAAGTTAAATTGTTGG + Intergenic
1115894270 14:38066775-38066797 AAATATTTAGATTAATTTATGGG + Intergenic
1116170012 14:41388557-41388579 AAAAATTTAGACTAAATTAGAGG + Intergenic
1116705906 14:48299610-48299632 TAATATTTAAGATAAATTTTTGG + Intergenic
1117175650 14:53143745-53143767 AAATATTTAGGCTAAATTGTAGG + Intronic
1117180289 14:53184354-53184376 AAATATTTAGGCTAAATTATGGG + Intergenic
1117347351 14:54846273-54846295 TATTATTTAGGTTAAATTGTTGG - Intronic
1117492123 14:56259108-56259130 AGAAATTTATGCTAAATTCTAGG - Intronic
1117926568 14:60785818-60785840 AAATATTTAAGCTAAACAGTTGG - Intronic
1117929833 14:60829412-60829434 AAATATTTAGTGTCAATAGTTGG + Intronic
1118025696 14:61766163-61766185 AAATATTTAGGCTAAATTGTGGG - Intronic
1118036317 14:61871853-61871875 AAGTTTTTAGGCAATATTGTTGG + Intergenic
1118396493 14:65341483-65341505 AAATATGTAACTTAAATTGTAGG + Intergenic
1119135598 14:72215780-72215802 AAATATTTAGGCTAAATTGTGGG + Intronic
1120756852 14:88252669-88252691 AAAGATTTAGTCTAAGATGTGGG - Intronic
1121078298 14:91087497-91087519 AAATATTTAAGCTAAATTGTAGG - Intronic
1121083124 14:91124878-91124900 AAATATTCAGGCTAAATTGTGGG - Intronic
1122170104 14:99866055-99866077 CAATATTTAGACTCCATTGTTGG - Intronic
1122615142 14:103012209-103012231 AACTGATTAGACTAAATTGTTGG - Intronic
1123776542 15:23586206-23586228 AAATATTTAGGCTAAATTGTGGG - Intronic
1123832315 15:24153062-24153084 AAATATTTAGGCTAAATTGTGGG + Intergenic
1123838032 15:24216203-24216225 AAATATTTAGGCTAAATTGTGGG - Intergenic
1123847581 15:24318498-24318520 AAATATTTAGGTTAAATTGTGGG - Intergenic
1123866623 15:24525881-24525903 AAATATTTAGGTTAAATTGTGGG - Intergenic
1123881726 15:24683034-24683056 AAATACTTAGGCTAAATTGTGGG - Exonic
1124238284 15:28008328-28008350 AAGTATTTAGGCTAAATTGTGGG - Intronic
1124387103 15:29218646-29218668 AAATATTTGGGCTTATTTCTGGG - Intronic
1124655763 15:31505355-31505377 AAATATTTAGGCTAAATTGTGGG + Intronic
1124656428 15:31512791-31512813 AAATATTTAGGTTAAATTGTGGG + Intronic
1125108090 15:35997494-35997516 AAATATTTAGGCTAAATTGTGGG - Intergenic
1125171990 15:36776026-36776048 AAATATTTAAGCCAAATACTTGG - Intronic
1125778423 15:42240650-42240672 AAATAATTTGGATAAATTCTAGG + Intronic
1125780104 15:42257647-42257669 TAATCTTTAGGCTAAATTCCTGG - Intronic
1126492187 15:49249786-49249808 AAATATTTAGGCTAAATTGTGGG - Intronic
1127950033 15:63795997-63796019 AAATATTTAGGCTAAATTGTGGG + Intronic
1128870321 15:71150273-71150295 AAGGATTTGGGCTAGATTGTTGG + Intronic
1130879131 15:88040037-88040059 AAATATTTAGGCTAAATTGTGGG + Intronic
1131010294 15:89011894-89011916 ATATATTTAGGCTAAATTGTGGG - Intergenic
1131033187 15:89203618-89203640 AAATAGTCTGGCTATATTGTGGG - Intergenic
1131588802 15:93725451-93725473 AAATACTTAGGCTAAGTTCGTGG - Intergenic
1133128289 16:3660935-3660957 TACTACTTAGGCTACATTGTGGG + Exonic
1133541014 16:6754078-6754100 AAATACTTAGGTAAAATTATGGG - Intronic
1135229666 16:20694008-20694030 AAATATTTAGGCTAAATTGTGGG - Intronic
1135240744 16:20805614-20805636 AAATATTTAGGCTAAATTGTGGG - Intronic
1135291846 16:21246406-21246428 AAATATTTAAGCTAAATTGTGGG + Intronic
1136638831 16:31544606-31544628 AAATATTTAGGCTAAATTGTGGG - Intergenic
1136914124 16:34165439-34165461 AAATATTTAGGGTAAAGAATAGG + Intergenic
1137039305 16:35595278-35595300 AGATATTCAGGCTAAAATGTGGG + Intergenic
1137039874 16:35600533-35600555 AAATATTTAGGCTAAATTCTGGG + Intergenic
1139263326 16:65616599-65616621 AAACATGTAGGCAAAATTATAGG - Intergenic
1139275281 16:65721997-65722019 CAAAATTTAGACTAAATTGGTGG + Intergenic
1139423486 16:66863906-66863928 AAATATTGAGGTTATTTTGTTGG + Intronic
1140734205 16:77883713-77883735 AAATGATGAGGCCAAATTGTTGG - Intronic
1140783933 16:78322036-78322058 AAATATTTAGGCAAAACATTTGG - Intronic
1140822427 16:78675417-78675439 AAATATTTAATCTAATTTATTGG + Intronic
1140864940 16:79051858-79051880 AAATATTTAGGCTAAACTGTGGG - Intronic
1140966923 16:79975925-79975947 AAAAATTTAGGGAAGATTGTTGG + Intergenic
1142235235 16:88919031-88919053 AGATACTTAGGCTAAATTGTGGG - Intronic
1142318178 16:89362707-89362729 AGATACTTAGGCTAAATTGTGGG - Intronic
1142322353 16:89391892-89391914 AGATATTTAGGCTAAATTGTGGG - Intronic
1142441281 16:90099457-90099479 AAATATTTAGGCTAAATTGTGGG - Intergenic
1143716781 17:8777984-8778006 ACATTTTGAGGCTACATTGTTGG - Intergenic
1143999929 17:11044301-11044323 AAATATTCAGGCTAAACTGTGGG - Intergenic
1147895975 17:43751646-43751668 AAACCTGAAGGCTAAATTGTAGG - Intergenic
1148177154 17:45576786-45576808 AAATATTTAGGCTAAATTGTGGG - Intergenic
1148788574 17:50159675-50159697 AAATAATTAGGAGAAAATGTAGG - Intergenic
1153002435 18:467921-467943 AAATATTTATTTTGAATTGTTGG + Intronic
1153367294 18:4271503-4271525 AAATATTTAACCAAATTTGTTGG + Intronic
1154053121 18:10982468-10982490 GAATTTTTAGACTAAATTTTGGG - Intronic
1155014970 18:21826190-21826212 AAATAGTTAAGCTAAAAGGTTGG + Intronic
1155230673 18:23771755-23771777 AAATATTAATGGTAAATTGTAGG + Intronic
1155574667 18:27231648-27231670 AAATATTTAGGCTAAATTGTGGG + Intergenic
1155796684 18:30046486-30046508 AAATATTTAGGCTGAAGTTCAGG - Intergenic
1155938145 18:31775722-31775744 AAATATTTAGGCTAAATTGTGGG - Intergenic
1156610676 18:38720269-38720291 AAATATTTAGGCTAAATTGTGGG - Intergenic
1157053054 18:44192238-44192260 AAAAATTTAGCAGAAATTGTTGG + Intergenic
1158451266 18:57567670-57567692 AAACATTTAGGTTAAAGTGAAGG + Intronic
1158759015 18:60362247-60362269 AAATATTCAGGCAAAGTAGTGGG - Intergenic
1158826940 18:61232285-61232307 AAGAATTAAGGATAAATTGTTGG + Intergenic
1158837496 18:61346392-61346414 AAATATTTATACCAAATTGAAGG + Intronic
1159318322 18:66810607-66810629 AAATATTGTTGATAAATTGTGGG + Intergenic
1159526671 18:69601140-69601162 AGATATTTAGACAAAATTTTAGG - Intronic
1159584080 18:70266386-70266408 AAATATTTAGTCTTTATTGCTGG - Intergenic
1159786060 18:72715721-72715743 AAATATTTAGAATAATTTATTGG + Intergenic
1160655439 19:265084-265106 AAATATTTAGGCTAAATTGTGGG - Intergenic
1160700719 19:505911-505933 AGATATTTAGCCTACATTGTGGG + Intergenic
1162237564 19:9321133-9321155 AAATATTTAGGCTAAATTGTGGG + Intergenic
1162265989 19:9574786-9574808 AAATATTTAGGCTAAATTGTGGG + Intronic
1162271841 19:9622061-9622083 AAATATCTAGGCTAAAATGTGGG + Intronic
1162271909 19:9622780-9622802 AAATATGTAGACTAAACTGTGGG + Intronic
1162288434 19:9759299-9759321 AATTATTTAGACTAAATTATGGG + Intronic
1162294526 19:9803985-9804007 AAACATTTAGGCTATAGTTTAGG - Intergenic
1162417752 19:10548342-10548364 AATTTTTTATGCAAAATTGTAGG + Intronic
1162652215 19:12098286-12098308 AAGTATTTAGGCTAACTTGTGGG + Intronic
1163110071 19:15154762-15154784 AAATTGTTAGACTAAATTTTTGG + Intergenic
1163210717 19:15837744-15837766 AAATATTTGGGCTAAATTGTGGG + Intergenic
1163927286 19:20357806-20357828 AAATATTTAGGCTAAACAGTGGG + Intergenic
1163946290 19:20538240-20538262 AAATATTTAGGCTAAATTGTGGG - Intronic
1163973100 19:20819582-20819604 AAATATTTAGGCTAAATTGTGGG + Intronic
1163984867 19:20936746-20936768 AAATATTTAGGCTAAAATGTGGG + Intronic
1164523051 19:28993457-28993479 AAATATTTAGGCTAAATTGTGGG - Intergenic
1165109225 19:33491846-33491868 AAATATTTAGGTTAAATTGTGGG + Intronic
1165294770 19:34917662-34917684 AAATATTTAGGCTAAATTGTGGG + Intergenic
1165359048 19:35322850-35322872 AAATCTTTAGGCTAAATTGTAGG + Intronic
1166411641 19:42559532-42559554 AAATATTTAGGCTAAATTGTGGG + Intronic
1166496793 19:43308752-43308774 AAATATCTAAGCTAAAATGTGGG + Intergenic
1167319531 19:48787767-48787789 AAATATTTAGGGTAAATTGTGGG + Intergenic
1167335468 19:48882813-48882835 AAATATTTAGGGTAAATTGTGGG + Intronic
1167838747 19:52096534-52096556 AAATATCTAGGCTAAAATGTGGG - Intergenic
1168175981 19:54628267-54628289 AAATATTTAGGCTAAATTGTGGG + Intronic
1168611638 19:57805249-57805271 AAATATTTAGGCTAAATTGTGGG + Intronic
1168626054 19:57918933-57918955 AAATATTTAGGCTAAATTGTGGG - Intergenic
1168642981 19:58042082-58042104 AAATATTTAGGCTAAATTGTGGG + Intronic
925229394 2:2219524-2219546 AAATATTTAGGCTAAATTGTGGG - Intronic
925468118 2:4128907-4128929 AAATTTTTAGTCTTTATTGTGGG - Intergenic
925660314 2:6195355-6195377 AAATATTTAGGCTAAACTGTGGG + Intergenic
925900631 2:8506904-8506926 AAATATTTATGCAAAACTCTGGG + Intergenic
927145182 2:20160315-20160337 AAAGAATTAGGATAAAATGTAGG - Intergenic
927418428 2:22903941-22903963 CAATATTTAGTCTTACTTGTTGG - Intergenic
927588640 2:24333643-24333665 AAATATATTGGGTAAATAGTAGG + Intronic
928055456 2:28049382-28049404 GTTTATGTAGGCTAAATTGTTGG + Intronic
929336752 2:40757137-40757159 AAATATTTAGATCATATTGTAGG + Intergenic
929395933 2:41522388-41522410 TAATATTTTGGATAATTTGTTGG - Intergenic
929421013 2:41789587-41789609 AAATATTTAGGACCTATTGTGGG - Intergenic
929448443 2:42019198-42019220 GAATATTTAGATTAAATTGCTGG + Intergenic
929929988 2:46246547-46246569 AAATATTTAGGCTAAATTGTGGG + Intergenic
929974097 2:46615625-46615647 ATATACTTAGGCTGAATTGTTGG + Intronic
930419015 2:51126135-51126157 AAATACTTAGGTTAATTTATAGG + Intergenic
930436555 2:51351398-51351420 ATATATTTGGACTGAATTGTAGG - Intergenic
930650760 2:53962097-53962119 AAATATTTAGGCTAAATTGTGGG + Intronic
930787025 2:55281147-55281169 AAATATTTAGGCTAAATTGTGGG + Intergenic
931451769 2:62373344-62373366 AAATATCTAGGCTAAAATATGGG + Intergenic
932240433 2:70152111-70152133 GACTATTTAGGCTAAAGTGGAGG - Intronic
933574238 2:84049121-84049143 AATCATTTAGACTGAATTGTCGG + Intergenic
933718260 2:85378102-85378124 AAATATTTAGGCTAAATTGTGGG + Intronic
934876963 2:97931589-97931611 AAAAATTTATGCCATATTGTGGG + Intronic
935044726 2:99470526-99470548 AAATATTTAGGCTAAATTGTGGG - Intronic
935330290 2:101972532-101972554 AAATATTTAGGCTAAATCGTGGG + Intergenic
935406587 2:102716592-102716614 AAATATTTATGATAAATAATTGG - Exonic
935787189 2:106559898-106559920 AAATATTTAGGCTAAACTGTGGG - Intergenic
935845373 2:107160465-107160487 AAATATTTAGGAACAGTTGTAGG + Intergenic
935954754 2:108364780-108364802 AAATATCTAGGCTAGAATGTGGG - Intergenic
936856126 2:116959284-116959306 AAATAAGTAGGATAAATTGCTGG - Intergenic
938126921 2:128681065-128681087 AAACACTTAGGCTAAATTATGGG - Intergenic
938161941 2:128993848-128993870 AAATGTTTAGACATAATTGTAGG - Intergenic
938536136 2:132250807-132250829 AAATATTTAGGGTAAAGAATAGG - Intronic
938593647 2:132764752-132764774 ACACATTTAGGCTTAATTGTAGG - Intronic
938747616 2:134294714-134294736 AAATATTTAGGCTAAATTGTGGG - Intronic
938839811 2:135149332-135149354 AAATACTTAGGTTATATTATAGG - Intronic
939059578 2:137404112-137404134 AAAAATTTAAGCAAAATTTTAGG + Intronic
939505166 2:143036551-143036573 AAATATTTAGGCTAAATTGTGGG + Intronic
939666550 2:144959649-144959671 AAATAATTAGACTATTTTGTGGG - Intergenic
939855055 2:147348647-147348669 AAATATGTAGGCAAAAATATAGG - Intergenic
940769130 2:157821638-157821660 AAATAAGTTGGCTAAATTTTTGG - Intronic
942171868 2:173297448-173297470 AAATAGTTGGGTTAAATAGTTGG + Intergenic
943651230 2:190459453-190459475 AAATTTTTAAACAAAATTGTAGG + Intronic
943747381 2:191476354-191476376 AAATATTTATGCAAACTTGTGGG + Intergenic
943909676 2:193547186-193547208 AAATATTTAGGTTTATTTCTGGG - Intergenic
944240806 2:197483399-197483421 AAATATTTAGGCTAAATTGTGGG - Intergenic
944284844 2:197937897-197937919 AAATATTTAGGAAACATTATGGG - Intronic
944381896 2:199120182-199120204 AAAAATTGAGGTTAAATTCTGGG - Intergenic
945291078 2:208128140-208128162 AAATATTTAGTCTGCATTGCTGG - Exonic
946349210 2:219137656-219137678 ATAACTTGAGGCTAAATTGTGGG - Intronic
946883429 2:224199031-224199053 AAATATTTAGGCTAAATTGTGGG - Intergenic
947159218 2:227194763-227194785 AAATATTGTGGCTAAATGTTTGG + Intronic
947996543 2:234532707-234532729 AAATATTTAAGCTAAATTGTGGG - Intergenic
1169032267 20:2418681-2418703 AAATACTAAGGATAAATTTTAGG - Intronic
1169295811 20:4397428-4397450 AAATATTTAGGGTAAACTTAAGG + Intergenic
1169364439 20:4980230-4980252 ATTTCTTTAGACTAAATTGTTGG - Intronic
1169710063 20:8551124-8551146 AAATTCTTTTGCTAAATTGTTGG + Intronic
1170709432 20:18776992-18777014 GCATATTTAGGCTAAATTGTGGG - Intergenic
1171766935 20:29294752-29294774 AAATATTTAGGATAAAGAATAGG - Intergenic
1171778899 20:29399875-29399897 AAATATTTGGGTTAATTTCTGGG + Intergenic
1171865031 20:30482629-30482651 AAATATTTAGGGTAAAGAATAGG - Intergenic
1171909032 20:30924011-30924033 AAATATTTAGGGTAAAGAATAGG + Intergenic
1174750098 20:53103500-53103522 AAATATTTTGTCTAATTTGTAGG + Intronic
1177309477 21:19371032-19371054 AAATATTTTCCCTAATTTGTAGG - Intergenic
1177604285 21:23358546-23358568 AGATATTTAGGGGAAATTGTGGG + Intergenic
1177685485 21:24432223-24432245 AAATATTTTGCTGAAATTGTCGG - Intergenic
1178619862 21:34164785-34164807 AAATATTTAGGCTAAACTGTGGG + Intergenic
1178706257 21:34875851-34875873 CATTATTTGGGCTAAAGTGTGGG - Intronic
1178862664 21:36302169-36302191 AAATATTTAGGCTAAATTGTGGG + Intergenic
1179016292 21:37596679-37596701 AAATATTTAGGCTAAATTGTGGG - Intergenic
1179317611 21:40258641-40258663 AGATATTTAAGCTAAATTGTGGG - Intronic
1179918316 21:44492674-44492696 AAATACCTAGACTAAAATGTGGG - Intergenic
1180311752 22:11247458-11247480 AAATATTTAGGGTAAAGAATAGG - Intergenic
1180659675 22:17455210-17455232 AAATAATTAGGCTAAGTTGTGGG + Intronic
1180673080 22:17568511-17568533 AAATATTGAGGCTAAACTGTGGG + Intronic
1181381791 22:22510346-22510368 AAATATTTAGGCTAAATTGTGGG + Intergenic
1181736778 22:24888292-24888314 AAATTTTTAGGATAAATCGTAGG - Intronic
1182729003 22:32472504-32472526 AAATATTTAGGCTAAATTGTGGG - Intergenic
1182923299 22:34099803-34099825 AAATATTTAGGCTAAATTGTGGG - Intergenic
1183048843 22:35244541-35244563 AAATATTTAGGCTAAACTGTGGG - Intergenic
1184975133 22:48056279-48056301 ATATACTCTGGCTAAATTGTGGG + Intergenic
1185401721 22:50622258-50622280 AGATATTTAGGCTAAATTGTGGG + Intergenic
949093010 3:51498-51520 AAATATTTAGGCCAAATTGTGGG - Intergenic
949726867 3:7058979-7059001 AAATATTTAGGCTAAACTGTGGG + Intronic
950084127 3:10245172-10245194 AAATATTTAGGCTAAATTGTGGG - Intergenic
950241820 3:11377234-11377256 AATTATTTTGGTTAAATTGTGGG + Intronic
951149112 3:19266287-19266309 AAATAATTAGGCTGAAGTCTGGG - Intronic
951555750 3:23918840-23918862 AAATATTTAGTATATATTTTAGG - Intronic
951591123 3:24266299-24266321 AAATGTTTTGGCTAAAGAGTAGG + Intronic
952697363 3:36283151-36283173 ACATATTTAGGCTAACATCTTGG + Intergenic
953248223 3:41216712-41216734 AATTATATAGGCTAACTTCTCGG + Intronic
953723142 3:45373824-45373846 AAATATTTAAGCTAAATTGTGGG - Intergenic
954020251 3:47734060-47734082 AAATATTCAGCATAAACTGTAGG + Intronic
954588153 3:51754751-51754773 AAATATTTAGGCTAAATTGTGGG + Intergenic
955417273 3:58704408-58704430 AAATATTTAGGCTAAATTGTGGG - Intergenic
957033273 3:75267597-75267619 AAATATTTAGGCCAAATTGTGGG - Intergenic
957535293 3:81494353-81494375 CAATACTTAGGCTAAATTTTAGG - Intronic
958034574 3:88154346-88154368 AAATATTTAGGTTCCAATGTGGG - Intronic
958509321 3:95025512-95025534 AAATATGTATGTTAAATTCTGGG - Intergenic
959840038 3:110964870-110964892 AAATATCTAGGCTAAAATGTGGG + Intergenic
959840650 3:110970110-110970132 AAATATCTAGGCTAAAATGTGGG + Intergenic
960214892 3:115020322-115020344 AAATACTGAGGCTAAACTGTTGG - Intronic
960244946 3:115389936-115389958 AAGTATTCAGGTTAAATTGCTGG + Intergenic
960625210 3:119675538-119675560 AAATATTTATGCTAAATGAAGGG + Intronic
960840098 3:121949083-121949105 ATATTTTGAGGCTATATTGTAGG + Intergenic
961361157 3:126368229-126368251 AAATATTTATGTTGAATAGTGGG + Intergenic
962079115 3:132118244-132118266 ATAAATTTTGGCAAAATTGTAGG + Intronic
962136123 3:132735650-132735672 TAATATTCAGTCCAAATTGTAGG - Intergenic
962400481 3:135055090-135055112 AAATGTTTAGAATAGATTGTTGG - Intronic
963216364 3:142753069-142753091 AAATATTCACACTTAATTGTAGG - Intronic
963427480 3:145150251-145150273 AAATATTGAGGCTAGAAAGTGGG + Intergenic
963936504 3:151059571-151059593 AAATATTTAGGTGATTTTGTTGG + Intergenic
964102790 3:153006956-153006978 AAATAATTTGGATAAAGTGTAGG - Intergenic
964667560 3:159190831-159190853 AGATATTTAGGTTAAGTTCTTGG + Intronic
965206685 3:165728230-165728252 AAAAATGTAGGTTAAATTGAGGG - Intergenic
965352434 3:167630379-167630401 AAATATTTAAGCTATACTGTAGG - Intronic
965357916 3:167699838-167699860 AAATATATAGGAAAAATTTTTGG + Intronic
965820413 3:172679251-172679273 AAATATTCAGGCTAAATTGTCGG + Intronic
968294099 3:197560280-197560302 AAATATTTAGGCTAAATTGTGGG - Intronic
968361538 3:198150433-198150455 AAATATTTAGGCTAAATTGTGGG - Intergenic
968455206 4:694466-694488 AAATATTTAGGCTAACTTGTGGG - Intergenic
968769447 4:2494832-2494854 AAATATTTAGGCTAAATTGTGGG + Intronic
969084284 4:4644038-4644060 AAATATTTAGGCTAAATTGTGGG + Intergenic
970973866 4:22020692-22020714 AGAAATTTTGGCTAAATTATTGG - Intergenic
971535979 4:27751961-27751983 AAATATTAACTCTAAATAGTGGG + Intergenic
971600496 4:28585649-28585671 AAACATTTAGGCTACATTGTGGG - Intergenic
971688544 4:29803062-29803084 TAATATTGAGGCAAAAATGTTGG - Intergenic
971723895 4:30283407-30283429 AAATATTTAGGCTAAATTGTGGG - Intergenic
971900080 4:32648016-32648038 AAATTTTTAAAATAAATTGTAGG - Intergenic
972019845 4:34298593-34298615 AAAAATTTAGTCTCAACTGTGGG + Intergenic
972802019 4:42486372-42486394 AAATATTTAGGCTAAATTGTGGG + Intronic
972876685 4:43370838-43370860 AAATATGTAGGGAAAATTGAAGG - Intergenic
973049570 4:45578499-45578521 AAATACTTAGTCTATAATGTGGG + Intergenic
973244139 4:47991977-47991999 AAGTATTTAGGCTTATTTCTGGG + Intronic
973608287 4:52609279-52609301 AAAAAGTTAAGCTAAAATGTTGG - Intronic
973857268 4:55025528-55025550 AAATATTTAGGCTAAATTGTGGG - Intergenic
974621688 4:64363724-64363746 AAATATTTAGGCTAAAGTGTGGG + Intronic
974973808 4:68865221-68865243 AAATATTTACACTAAATTGTGGG - Intergenic
974980786 4:68954972-68954994 AAATATTTAGGCTAAATTGTGGG - Intergenic
974997424 4:69178394-69178416 AAATATTTAGGCTCCATTGTAGG + Intronic
975002279 4:69239286-69239308 AAATATTTACGCTACATTGTAGG + Intergenic
975007615 4:69310438-69310460 AAATATTTAGGCTACATTGTAGG - Intronic
975010388 4:69343328-69343350 AAATATTTAGGCTACATTGTAGG + Intronic
975033305 4:69651226-69651248 AAAGATTTGGCCTAAAATGTGGG + Intronic
975061482 4:70007964-70007986 AAATATGTAGGCTATATTTAAGG + Intergenic
975905481 4:79206505-79206527 AAATATTTAGGCTAAATTGTGGG - Intergenic
977103944 4:92856214-92856236 AAATATGTCGTGTAAATTGTTGG - Intronic
977988374 4:103412873-103412895 AAATATTTAGGCTAACTTGTGGG + Intergenic
978061857 4:104348875-104348897 GAATATTTATTTTAAATTGTAGG + Intergenic
978168387 4:105636908-105636930 AAATATTAAGGTGAAATAGTTGG + Intronic
978366421 4:107987923-107987945 AAATATTTAGGCTAAATTGTGGG - Intergenic
978369110 4:108012719-108012741 AAATATTTAGGCTAAATTGTGGG + Intronic
979100535 4:116606497-116606519 AAATATTTAGGCTAAATTGTGGG + Intergenic
979575185 4:122282307-122282329 CAATTCTTAGGCTATATTGTGGG - Intronic
979614840 4:122731335-122731357 AAATAATGAGGCTATATTGCAGG - Intergenic
979641914 4:123018345-123018367 AATAATTTAGACTATATTGTAGG + Intronic
979723371 4:123930541-123930563 AAAGTTTTAGGTAAAATTGTAGG - Intergenic
979838645 4:125407261-125407283 AAATATATATGCTGGATTGTTGG + Intronic
979884716 4:126012346-126012368 AAAAATTCAGGATAACTTGTAGG + Intergenic
979888814 4:126064279-126064301 AAATATTCAGGCTAAATTGCAGG + Intergenic
980004822 4:127529992-127530014 AAATATTTAGGCTAAATTATGGG - Intergenic
980225659 4:129980736-129980758 AAATATCCATGCTTAATTGTAGG + Intergenic
980263410 4:130483710-130483732 AAATATTTGGGCTTATTTCTGGG - Intergenic
980386452 4:132091937-132091959 AAATATTAACAATAAATTGTAGG + Intergenic
980414579 4:132468376-132468398 AAATTTTCAAGCTAAATTTTGGG + Intergenic
981207274 4:142057814-142057836 TAAAATTTTTGCTAAATTGTAGG - Intronic
981816573 4:148837699-148837721 AAATACTTAGGCTAAGTTATGGG - Intergenic
982430995 4:155321827-155321849 AAATATTCAGAATAAATTCTAGG - Intergenic
982456553 4:155616930-155616952 AATTATTGAAACTAAATTGTAGG - Intergenic
983698607 4:170564042-170564064 AAATTTTTAGGCTAGATCTTTGG + Intergenic
983718984 4:170822153-170822175 CAATATTTTAGCTAAAATGTTGG + Intergenic
984351884 4:178605052-178605074 AATTATTTACACTAAATTCTTGG - Intergenic
984940030 4:184922893-184922915 AAATATTTAGGCTAAATTGTGGG - Intergenic
985238426 4:187902301-187902323 AAATATTTAGGCTAAACTGTGGG + Intergenic
985443762 4:190007139-190007161 AAATATTTGGGTTAATTTCTGGG + Intergenic
986160972 5:5228838-5228860 AAATATTCAGGCTAAAATGTGGG - Intronic
986554013 5:8992231-8992253 AAATAATTAGGTTGAATTTTGGG + Intergenic
987221771 5:15797788-15797810 AAATTTCTCGTCTAAATTGTAGG - Intronic
988344318 5:30018295-30018317 ATTTATTTAGGGTAAGTTGTTGG - Intergenic
988604361 5:32667258-32667280 AAATACTTGGGTTAAATTCTGGG + Intergenic
988897427 5:35692885-35692907 AAATATTTAGGACAAATTTTAGG + Intronic
990588129 5:57232432-57232454 AAATATTTAGGCTTAATTGTAGG - Intronic
991090746 5:62691486-62691508 AAATATTTAGGCTAAATTGTGGG + Intergenic
991142895 5:63266690-63266712 AGATATTGTGACTAAATTGTTGG - Intergenic
991181621 5:63758027-63758049 AAGTATTTAGGCTAAATTGTTGG - Intergenic
991192154 5:63887276-63887298 AAATATTTAGGCTAAATTGTGGG - Intergenic
991339279 5:65588859-65588881 AAAAATTTAATCTAAATTTTTGG + Intergenic
991441769 5:66658219-66658241 AAATATATAGGTTACATAGTTGG + Intronic
992160973 5:74001237-74001259 AGATATTTTGGGTAAATTTTTGG + Intergenic
992479035 5:77132015-77132037 AAATATTTTTGCTTAGTTGTAGG - Intergenic
993179927 5:84539702-84539724 AAATATTTAGGCTAAATTGTGGG - Intergenic
993202493 5:84834203-84834225 AAATATTTAGGCTAAATTGTGGG - Intergenic
993240987 5:85385046-85385068 AAATTTTTATTCTAAATTTTTGG + Intergenic
993680897 5:90876295-90876317 AAATCTTTAAATTAAATTGTTGG + Intronic
994032109 5:95155354-95155376 AAGGATTTAGGCAAGATTGTTGG + Intronic
994153547 5:96476471-96476493 AAATATTTAGGCAGAACTGTGGG + Intergenic
994378784 5:99045126-99045148 AATAATTTATGCTAAGTTGTTGG - Intergenic
994688872 5:102991283-102991305 AAATTGTTTAGCTAAATTGTGGG - Intronic
995416024 5:111914332-111914354 AAATATTTAGGGTAAAATGTGGG - Intronic
996717517 5:126599955-126599977 AAATATTTAGGCTAAATTGTGGG - Intergenic
996720314 5:126623706-126623728 AACTATTTAGCATAAATTTTAGG + Intronic
997285889 5:132678117-132678139 ATTTATGTAGGCTAAATTCTAGG - Intronic
997408543 5:133671866-133671888 AAATATTTAGGCTAAATTGTGGG + Intergenic
997534988 5:134612975-134612997 AAATATTTAGGCTAAATTGTGGG - Intronic
998964387 5:147523408-147523430 AAATATTTATGCCATATTGAGGG + Intergenic
999347011 5:150832353-150832375 AAATATTTAGGCTAAATTGTGGG + Intergenic
999347558 5:150837674-150837696 AAATATTTAGGCTAAATTGTAGG + Intergenic
999535986 5:152518164-152518186 AAATAGTTAAACTAAATTGAAGG - Intergenic
999580545 5:153033591-153033613 AAATATTTAGGCTAAATTGTGGG + Intergenic
999833821 5:155347746-155347768 AAATATTTAGGCTAAACTGTGGG - Intergenic
1000299433 5:159942518-159942540 AGATCTTTAAGATAAATTGTTGG + Intronic
1000327917 5:160186332-160186354 AAATATCTAGGCTAAAATGTGGG - Intergenic
1000660055 5:163927393-163927415 AATTATATAGGCTAGATTGAAGG - Intergenic
1000852803 5:166361632-166361654 AAATATTTAGTCTATAAGGTGGG + Intergenic
1001467400 5:171980099-171980121 AAATACTTAAGCTAAATTGTGGG + Intronic
1002207751 5:177575428-177575450 AAATATTTAGGCTAAATTGTGGG + Intergenic
1003041456 6:2691264-2691286 TAATATTTATGCTTAATTCTTGG + Intronic
1003475617 6:6479406-6479428 AGATATTTAGGCTAAATTGTGGG + Intergenic
1003518859 6:6840581-6840603 AAACAGTTAGTATAAATTGTTGG - Intergenic
1003706589 6:8538277-8538299 CAATATATTGGCTAAATAGTAGG - Intergenic
1004525803 6:16406636-16406658 AAATATTTAGGCTAAATTGTGGG - Intronic
1005060002 6:21767058-21767080 ATATATTTATACTAATTTGTAGG + Intergenic
1006412219 6:33880710-33880732 AAATATTTAGGCTAAATTGTGGG - Intergenic
1006826283 6:36938632-36938654 AAACATTTAGACTAAACAGTTGG + Intergenic
1007279198 6:40698047-40698069 AGATATTTAGGGAAAAATGTTGG - Intergenic
1007580261 6:42954494-42954516 AAATATTTAGGCTACATTGTGGG - Intergenic
1007908238 6:45486034-45486056 CAATATTTGGGCAAAATAGTAGG - Intronic
1008283731 6:49625174-49625196 AAATATTTTGGCAAATCTGTTGG + Intronic
1008353920 6:50528690-50528712 AAGTATGTTGGCTAGATTGTTGG - Intergenic
1008699678 6:54083864-54083886 AAATAATTTAGGTAAATTGTTGG + Intronic
1008735089 6:54533583-54533605 CACTATTTGGGCTAAATTATAGG + Intergenic
1009846327 6:69140023-69140045 AATTATCTAGGCTACAGTGTAGG - Intronic
1010512779 6:76741001-76741023 AAATATTTAGGTTTATTTCTGGG + Intergenic
1010719740 6:79269509-79269531 AAATATTTAGGAAATATTTTTGG + Intergenic
1011426179 6:87233750-87233772 AAATGCTTTGGCTAAATTGTGGG + Intronic
1011455021 6:87539427-87539449 AGATATTTAGGCTAAATTGTAGG - Intronic
1012449095 6:99336261-99336283 AAATATTTAGGAAAAATTAAAGG - Intronic
1012666266 6:101974946-101974968 AAAAATTAAGGGTAAATTATAGG + Intronic
1013216329 6:108030887-108030909 AATTATTTAGGCTTAATTCCTGG - Intergenic
1013739813 6:113269053-113269075 GAATATTTAGGGACAATTGTGGG - Intergenic
1014110481 6:117615440-117615462 AAATATTTAGGCTAAATTGTGGG - Intergenic
1014111356 6:117621583-117621605 AAATATTTAGGCTAAATTGTGGG - Intergenic
1015242862 6:131045295-131045317 AAATATTTTGTGTAAAATGTGGG - Intronic
1016149154 6:140717537-140717559 AAAAATAAAGGCTAAATTATTGG - Intergenic
1016700078 6:147044439-147044461 AAATATCTAGGCTAAAATGTGGG + Intergenic
1016890606 6:149003383-149003405 AAATATTTTGGCAAAAATTTTGG - Intronic
1017349110 6:153418945-153418967 AAATGTTTAGGTTAAGTTGAAGG + Intergenic
1017720952 6:157242757-157242779 AAATATTTCGGCTCTACTGTGGG + Intergenic
1018136954 6:160788281-160788303 AAATATTTAGTCTAAATTGTGGG - Intergenic
1018193409 6:161331862-161331884 AAATACTTAGGCTAAATTGTGGG - Intergenic
1018590080 6:165409815-165409837 AATTATTTAGGGTAAAATTTTGG - Intronic
1018949005 6:168366274-168366296 AACTATTTAGGCTAAATTGTGGG - Intergenic
1019254147 7:38287-38309 AAATATTTAGGCTAAATTGTGGG + Intergenic
1019946755 7:4335868-4335890 AAATATTTAGGCTAAATTGTGGG + Intergenic
1021722030 7:23513999-23514021 AAATACTTAGGCTAAATTGTGGG + Intronic
1022623843 7:32013698-32013720 AAATATTTTGGCTAAATTGTGGG + Intronic
1023269800 7:38450256-38450278 AAAGATTTAGGAAAAATAGTTGG + Intronic
1023597870 7:41851843-41851865 AAATAGTGAGCCTAAAGTGTTGG + Intergenic
1023756263 7:43420112-43420134 AAATATTTAGGCTAAATTGTGGG + Intronic
1024500941 7:50105050-50105072 AAATATTTAGGTTTAAATTTTGG - Intronic
1024619813 7:51147696-51147718 AAATATTTAGGCGAAATTGCGGG + Intronic
1024843915 7:53620081-53620103 AAATATTTAGGCTAAATTGTGGG + Intergenic
1024997688 7:55286187-55286209 AAATTTCTAAGCTAAATTTTTGG - Intergenic
1026066249 7:67075982-67076004 AAATATTTAGGCTAAATTGTGGG - Intronic
1026288167 7:68982110-68982132 AAATATTTAGGCTAAATTGTGGG - Intergenic
1026710680 7:72736356-72736378 AAATATTTAGGCCAAATTGTGGG + Intronic
1027731153 7:81874917-81874939 AAATTTTCAGTCTAAATTGATGG + Intergenic
1028131292 7:87177011-87177033 AAATATTTAGGTTTAATCATTGG + Intronic
1028292157 7:89078537-89078559 AAATATTTAGGTAATATTGAAGG - Intronic
1028802958 7:94988838-94988860 AAAAAATCAGGCTAAATTATGGG - Intronic
1030207802 7:106967584-106967606 AAATATTTAGGCTAAATTGTGGG - Intergenic
1030788143 7:113687660-113687682 AAATATTTATGTTATATTGAAGG + Intergenic
1031308270 7:120161549-120161571 AAATACTTAGGATAAAGTATGGG + Intergenic
1031350559 7:120725480-120725502 TAATATTTAGGCTGTATTTTGGG - Intronic
1032211864 7:129922687-129922709 AAATATTGAGTCTACATAGTAGG + Intronic
1032937668 7:136752159-136752181 AAATATTTAGGCTAAATTGTGGG - Intergenic
1033489758 7:141831291-141831313 AAATAATTTTGCCAAATTGTAGG - Intergenic
1033636588 7:143217784-143217806 AGATATTTGGCCTCAATTGTTGG - Intergenic
1034585005 7:152082580-152082602 AGATATTTAGGCTAAAGTGTGGG + Intronic
1035133854 7:156680643-156680665 AATTATTGATGCTACATTGTGGG + Exonic
1037092196 8:14934071-14934093 GAATATTTAGTATAAATTATTGG - Intronic
1037130882 8:15406430-15406452 AAATATTTAGGCTAAATTGTGGG + Intergenic
1038060887 8:23911390-23911412 CATTTTTTAGGCTACATTGTTGG - Intergenic
1038525121 8:28266437-28266459 AAATATTTAGGCTAATTTGTGGG + Intergenic
1039004784 8:33022705-33022727 AAATATTTACGCTAAATTGTAGG - Intergenic
1039038813 8:33387479-33387501 AAATATTTAAGAAAAGTTGTTGG + Intronic
1039622877 8:39015894-39015916 AAATGTTTAGGCAAAATTCCAGG - Intronic
1039699482 8:39947397-39947419 AAATATTTAGGCTAAATTGTGGG - Intronic
1039799725 8:40943723-40943745 AAATATTTAGGCTAAACTGTGGG + Intergenic
1039961772 8:42254027-42254049 AAATATTTAGGCTAAATTGTGGG + Intergenic
1040848869 8:51877469-51877491 AAATATTTAGGCTAAATTGTGGG + Intronic
1040859092 8:51980445-51980467 AAATATTTATGTGAAGTTGTTGG + Intergenic
1040992157 8:53363849-53363871 AAAGATTAAGGATTAATTGTGGG + Intergenic
1041066600 8:54088156-54088178 AAATATTTAGGCTAAATTGAGGG + Intronic
1041191883 8:55363334-55363356 AAGTATTCAGGATAAACTGTTGG - Intronic
1041499884 8:58529181-58529203 AAATATTTATACTCAAATGTTGG + Intergenic
1041514078 8:58681168-58681190 AAATATTTCTTCCAAATTGTGGG - Intergenic
1041745307 8:61202172-61202194 AAATATTTAGGCTAAGTTGTAGG + Intronic
1042102566 8:65289205-65289227 TAATATTTACACTAAATTGTGGG - Intergenic
1042517824 8:69678171-69678193 AAAGACTTAGGCAAAATTCTTGG - Intronic
1043802085 8:84622019-84622041 AAACATTTAAGTTAAATTATTGG - Intronic
1044042044 8:87382284-87382306 AATTATTTTCTCTAAATTGTTGG - Intronic
1044338310 8:91015958-91015980 AAATATTTAGGCTAAATTGTGGG + Intronic
1044342576 8:91064220-91064242 AAATATTGAGCATAAATTATAGG + Intergenic
1044768797 8:95606980-95607002 AATTATTTTGGCAAAATTTTTGG - Intergenic
1044908744 8:97033922-97033944 AAATAGTTATTTTAAATTGTGGG + Intronic
1045178413 8:99752579-99752601 AAATATTTAGGCTAGATCTAGGG - Intronic
1045593137 8:103621524-103621546 AAATATTTAGGCTAAACTGTGGG + Intronic
1046437420 8:114209988-114210010 AAATGTTCAGGTGAAATTGTTGG - Intergenic
1046499383 8:115056067-115056089 AAATACTTAGTATAAATAGTTGG - Intergenic
1047665938 8:127091201-127091223 AAATATTTAGGTTAAATTGTGGG - Intergenic
1047973215 8:130104313-130104335 AAAGATTCAGGCTAAATTTTGGG - Intronic
1048247531 8:132824559-132824581 AAATATGTTGGATAAATTATAGG + Intronic
1049461803 8:142733286-142733308 AAATATTTAGGCTAAATTGTGGG + Intronic
1050999516 9:12263888-12263910 AAATATTTATTATAAATTGAGGG + Intergenic
1052081865 9:24215835-24215857 AAATATTTAGGCATAATTCTTGG - Intergenic
1052673806 9:31593548-31593570 AAACATTTAAGTTTAATTGTTGG + Intergenic
1053884669 9:42635291-42635313 AAATATTTGGGTTAATTTCTGGG - Intergenic
1054970318 9:71078770-71078792 AAATATTTAGCTAAAATTCTAGG - Intronic
1055034285 9:71801436-71801458 GAATATTTATTCTAAAATGTGGG + Intronic
1055170184 9:73247932-73247954 AAATATTTAATCTAAAAAGTAGG - Intergenic
1056373152 9:85979467-85979489 AAATATTTAGGCTAAATTCTGGG + Intronic
1056920341 9:90782190-90782212 AAATATTTAGGCTAAATTGTGGG + Intergenic
1057013525 9:91630232-91630254 CAAGATCTAGGCTAAACTGTAGG - Intronic
1057237637 9:93377196-93377218 AAATTTTTAGGATAATTTTTAGG - Intergenic
1057615090 9:96582313-96582335 AAATATTTAGGCTAAATTGTGGG - Intronic
1057834908 9:98436715-98436737 AAGTATTTAAGCAAAATTCTAGG - Intronic
1058125846 9:101193858-101193880 AAATATGTAGGCATAATTATTGG + Intronic
1058159384 9:101551117-101551139 AAATATTAAGGATAAATTATTGG + Intronic
1059200801 9:112414115-112414137 AAATATTTAGGCTAAATTGTGGG + Intronic
1059818452 9:117945001-117945023 AAATATTTAGGCTACATTGTGGG + Intergenic
1060600578 9:124874767-124874789 AAATAAGTAGGGTAACTTGTTGG + Intronic
1061501448 9:131005301-131005323 AAATATTTAGGCTAAATTGTGGG - Intergenic
1061562267 9:131413104-131413126 AAATATTCAGGCTAAATTGTAGG - Intronic
1062746256 9:138214254-138214276 AAATATTTAGGCTAAATTGTGGG - Intergenic
1185513949 X:684376-684398 AAATATTTAGGCTAAATTGTGGG + Intergenic
1185703771 X:2251323-2251345 TGATACTTAGGTTAAATTGTGGG - Intronic
1186008367 X:5100676-5100698 TAATATGTATGCTAAAGTGTTGG - Intergenic
1186179405 X:6958358-6958380 AAATATTTAGGCTAAATTGTGGG + Intergenic
1186717855 X:12272312-12272334 AAGTATTGAGGATAAAGTGTTGG + Intronic
1187042040 X:15607035-15607057 AAATATTTAGGTTAAATTGTGGG - Intergenic
1187229362 X:17406017-17406039 AAATTTTCAAACTAAATTGTTGG - Intronic
1187244765 X:17544285-17544307 AAAAATTGAGTCCAAATTGTCGG - Intronic
1187863206 X:23700990-23701012 AGATATTTAGGTCAAATAGTAGG - Intergenic
1188157446 X:26756996-26757018 AAATATTTAGGCTAAATTGTGGG - Intergenic
1188207259 X:27375760-27375782 AAATATTTAGGCTAAATTGTGGG - Intergenic
1188688443 X:33099034-33099056 AAATATTTAGGCTAAATTGTGGG + Intronic
1188714530 X:33445057-33445079 AAATATGCAGCCAAAATTGTAGG - Intergenic
1188878502 X:35462429-35462451 AAATATTTAGAGTAAATTGTGGG - Intergenic
1189025114 X:37386577-37386599 TAATATTTTGTTTAAATTGTAGG + Exonic
1189300959 X:39951958-39951980 AATTATTTTGGTTCAATTGTAGG - Intergenic
1189416903 X:40823293-40823315 AAATACTTAGGCTAAATTGTGGG - Intergenic
1189516731 X:41719897-41719919 AAATATTTAGGCTAAATTGTGGG + Intronic
1189544928 X:42033028-42033050 GGAAATATAGGCTAAATTGTAGG - Intergenic
1189620634 X:42833706-42833728 AAATATTTAGGCTAAATCGTGGG - Intergenic
1189665452 X:43350377-43350399 AAATATTTAGGCTAAATTGTGGG - Intergenic
1189784324 X:44545760-44545782 AAATATTGAGGCTAAATTGTAGG + Intergenic
1189964661 X:46360171-46360193 AAATATTTAGGCTAAATTGTGGG + Intergenic
1190136286 X:47801958-47801980 AGATATTTGGTCTAAATTGGGGG - Intergenic
1191846919 X:65553780-65553802 AAATATTTAGGCTAAATTGTGGG - Intergenic
1191994447 X:67076660-67076682 AAATATTTGGGTTAATTTCTGGG - Intergenic
1191997312 X:67109400-67109422 AAATATTTGGGTTAATTTATGGG + Intergenic
1192055933 X:67773215-67773237 AAAAATTAAGGCTAAACTGAAGG + Intergenic
1192057833 X:67790320-67790342 AAATATATATGGAAAATTGTTGG + Intergenic
1192319462 X:70077837-70077859 AAATATTTAGGCTAAATTGTGGG + Intergenic
1192573945 X:72227912-72227934 AAATATTTAGGCTAAATTGTAGG - Intronic
1193381034 X:80816047-80816069 AAAATTATAGGCTAAACTGTAGG + Intergenic
1193718465 X:84959351-84959373 AAATATTTAGGCTAAATTTTGGG - Intergenic
1193812564 X:86068760-86068782 AAATATTTAGGCTAAATTGTGGG - Intergenic
1193972565 X:88074075-88074097 AAATATTTAGGGAATATTTTAGG + Intergenic
1194070266 X:89315162-89315184 AAATATATATGCTATTTTGTTGG - Intergenic
1194109766 X:89818844-89818866 AAATTTTTAAACAAAATTGTGGG + Intergenic
1194198205 X:90922746-90922768 AAATATTTAGGCTAAATTGTGGG - Intergenic
1194369324 X:93051422-93051444 AAATATTTAGGCTAAATTGTGGG + Intergenic
1194428534 X:93771017-93771039 AAATATTTAGGCTAAATTCTGGG + Intergenic
1195131435 X:101857759-101857781 AAAGATTTAAGCAAAATTATAGG - Intergenic
1195402315 X:104474344-104474366 AAATCCTGTGGCTAAATTGTTGG - Intergenic
1195878745 X:109570994-109571016 CAAGATTCAGTCTAAATTGTAGG - Intergenic
1196220457 X:113108527-113108549 AAATATTTAAGCTCTATTTTAGG + Intergenic
1197344098 X:125311075-125311097 TAATATTTAGGATAAATAGAAGG + Intergenic
1197360270 X:125493126-125493148 AAATATTTAGGCTAAATTGTGGG - Intergenic
1198997050 X:142585189-142585211 AGACATTTAGGCTTAATTCTTGG - Intergenic
1199151737 X:144494910-144494932 TTATATTTAGGCTAAATTGTGGG + Intergenic
1199221934 X:145326618-145326640 AAATATTTAGGCTAAATTGTGGG + Intergenic
1199234479 X:145475084-145475106 AAATATTTAGGCTAAATTGTGGG + Intergenic
1199916168 X:152343217-152343239 AAATTTTTAGGCTACAGTGCAGG - Intronic
1200462434 Y:3473582-3473604 AAATTTTTAAACAAAATTGTGGG + Intergenic
1200543532 Y:4490085-4490107 AAATATTTAGGCTAAATTGTGGG + Intergenic
1200677516 Y:6167647-6167669 AAATATTTAGGCTAAATTGTGGG + Intergenic
1200724505 Y:6650786-6650808 AAATATATATGCTATTTTGTTGG - Intergenic
1200762467 Y:7052814-7052836 AAATATTTAGGCTAAATTCTGGG + Intronic
1200776434 Y:7174049-7174071 AAATATCTAGGCCTAATTTTAGG + Intergenic
1201641386 Y:16180880-16180902 AAATATTTATGCTAAATTGTGGG - Intergenic
1201661429 Y:16404442-16404464 AAATATTTATGCTAAATTGTGGG + Intergenic
1201668872 Y:16492708-16492730 AAATATTTAGGATAAATTGTGGG - Intergenic
1201761883 Y:17549317-17549339 AAATATTTGGGTTAATTTCTGGG + Intergenic
1201839669 Y:18356673-18356695 AAATATTTGGGTTAATTTCTGGG - Intergenic
1202040894 Y:20682436-20682458 AAATATTTATGTTACATTTTAGG - Intergenic