ID: 1006412220

View in Genome Browser
Species Human (GRCh38)
Location 6:33880711-33880733
Sequence CAAATATTTAGGCTAAATTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 576
Summary {0: 151, 1: 94, 2: 38, 3: 32, 4: 261}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006412220_1006412226 14 Left 1006412220 6:33880711-33880733 CCACAATTTAGCCTAAATATTTG 0: 151
1: 94
2: 38
3: 32
4: 261
Right 1006412226 6:33880748-33880770 TACTGGTCCAAGCAAGCATTAGG 0: 135
1: 98
2: 46
3: 35
4: 81
1006412220_1006412224 -3 Left 1006412220 6:33880711-33880733 CCACAATTTAGCCTAAATATTTG 0: 151
1: 94
2: 38
3: 32
4: 261
Right 1006412224 6:33880731-33880753 TTGTCCTGGGTTGCTTATACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006412220 Original CRISPR CAAATATTTAGGCTAAATTG TGG (reversed) Intergenic
900813647 1:4826929-4826951 CAAATATTTAGGCTAAATTGTGG - Intergenic
901479169 1:9512474-9512496 CAAATATTTAGGCTAAATTGTGG - Intergenic
901913070 1:12476637-12476659 CAAAGAGGTAGGCTAAATTTAGG - Intronic
902700008 1:18165741-18165763 CAAATATTTAGGCTAAATTGTGG - Intronic
902946947 1:19847874-19847896 TAAACATTTAGTCTAAATTAAGG - Intergenic
903206763 1:21788231-21788253 CAAATATTTAGGCTAAATTGTGG + Intergenic
903252997 1:22070298-22070320 CAAATATTTAGGCTAAATTGTGG - Intronic
903819794 1:26093506-26093528 CAAATATTTAGGCTAAATTGTGG - Intergenic
904308430 1:29607177-29607199 AAAATATTTTGTCTAATTTGGGG + Intergenic
905536374 1:38725439-38725461 CAAATATTTAGGCTAAATTGTGG - Intergenic
906883722 1:49621522-49621544 CAAATATTTAGGCTAAATTGTGG + Intronic
907226254 1:52949769-52949791 CAAATATTTAGGCTAAATTGTGG + Intronic
908139387 1:61168127-61168149 CATATATTTATGTTAACTTGGGG + Intronic
908830699 1:68175463-68175485 CAAATTGTTTGGCTAAATAGTGG - Intronic
908892290 1:68861316-68861338 CAAATATTTGGGTGAAATTCTGG + Intergenic
909443404 1:75722921-75722943 CAAATATCTAGGCTAAAATGTGG - Intergenic
909463752 1:75949056-75949078 CAAATATTTAGGCTAAATTGTGG - Intergenic
909733615 1:78928676-78928698 CAAATAACTATGCTAAGTTGTGG + Intronic
909856992 1:80547538-80547560 CAAATATTTAGGCTAAATTGTGG - Intergenic
909955065 1:81769496-81769518 CAAATATATAACCTAATTTGTGG + Intronic
911032574 1:93505587-93505609 TAAATATTTAGGCTAAATTGTGG + Intronic
911283069 1:95955619-95955641 CAAATATTTAGGCTAAATTGTGG - Intergenic
911493895 1:98606378-98606400 CACATATTTAGGCTAATATGAGG + Intergenic
911577496 1:99595951-99595973 CAAATACTTAGACAAAAATGTGG - Intergenic
912338804 1:108889476-108889498 CAAATACTTAGGCTAAATTGTGG + Intronic
912438960 1:109683816-109683838 CAAGTATTTAGGCTAAATTGTGG - Intronic
912441482 1:109702261-109702283 CAAGTATTTAGGCTAAATTGTGG - Intronic
913488574 1:119356928-119356950 TAAATATTTAGGCTAAATTGTGG + Intergenic
913518821 1:119626634-119626656 CAAGTATTTTGGCTAATTTAAGG + Intronic
913942597 1:125121952-125121974 CAAATTAATTGGCTAAATTGGGG - Intergenic
914438070 1:147678200-147678222 CAAATATTTAGGCTAACTTGTGG + Intergenic
915820912 1:159022693-159022715 CAAATATTTAGGCTAAATTGTGG + Intronic
916771295 1:167911376-167911398 CAAATATTTAGGCTACATTGTGG - Intronic
916911693 1:169355797-169355819 CAAATATGTAGTATAATTTGAGG - Intronic
917237333 1:172908362-172908384 CAACTATGTAGGCTTATTTGTGG - Intergenic
917306980 1:173637417-173637439 CAAATACCTATGCTAAAATGTGG - Intronic
917307623 1:173642619-173642641 CAAATATCTAGGCTAAAATGTGG - Intronic
918229405 1:182514519-182514541 CAAATACTTGGGTTAAATTCTGG + Intronic
918518930 1:185393169-185393191 TAAATATTTAGTCTTAATTTGGG - Intergenic
919350602 1:196448907-196448929 AAAATATTTCCCCTAAATTGTGG + Intronic
921494316 1:215819348-215819370 CAAATATTTATGTTAAAAAGCGG + Intronic
921661940 1:217813573-217813595 CAAATAATTAGGTGTAATTGAGG + Intronic
922238694 1:223740642-223740664 AAAATACTTAGGCTAAATTGTGG + Intronic
922976676 1:229790611-229790633 CAAATATTTAGGCTAAATTGTGG - Intergenic
923309126 1:232718170-232718192 CAAATATTTAGGCTAAACTGTGG + Intergenic
923309229 1:232719442-232719464 CAAATATCTAGGCTAAAATGTGG + Intergenic
923312193 1:232745917-232745939 CAAATATTTAGGCTAAACTGCGG + Intergenic
923330008 1:232914493-232914515 CAAATATTTAGGCTAAATTGTGG + Intergenic
923357747 1:233177208-233177230 CAAGTATTTAGGCTAAATTGTGG - Intronic
923922961 1:238589305-238589327 CAATTATTGGTGCTAAATTGGGG - Intergenic
923934771 1:238748196-238748218 CAAATATTTGGGTTAAGTTCTGG - Intergenic
924806978 1:247369243-247369265 CAGATATTTAGGCTAAATTGTGG + Intergenic
1063026960 10:2189362-2189384 CAAATATTTGGGCTACATTTTGG - Intergenic
1063493735 10:6488274-6488296 AAAATATTTAGGTGAAATTTGGG + Intronic
1063553217 10:7052874-7052896 CAAATACTTAGGGTAAAGTTTGG + Intergenic
1064291846 10:14042169-14042191 CAAATATTTAGGCTACATGGTGG - Intronic
1064820777 10:19329418-19329440 TAAATATTTTGTTTAAATTGGGG - Intronic
1064831520 10:19473131-19473153 TAAATTTTGAGGATAAATTGAGG + Intronic
1066239670 10:33521375-33521397 CCAATAATTAGCCTAAAGTGGGG + Intergenic
1066247822 10:33600883-33600905 CAAATATTTAGGCTAAATAGTGG - Intergenic
1068135136 10:52945652-52945674 TAAATATTTAGGCTAAATTGTGG - Intergenic
1069177491 10:65311847-65311869 CAAATAATCATGCTACATTGTGG - Intergenic
1069213651 10:65792602-65792624 CAAGTATTCAGGCTAAATTGTGG + Intergenic
1069450861 10:68516481-68516503 CAAATATTTAGGCTAAATTGTGG + Intronic
1069452746 10:68530255-68530277 CAAATATTTAGACTAAATTGTGG + Intergenic
1070855882 10:79607822-79607844 CAAATATTTGGGTGAAATTCTGG + Intergenic
1071370973 10:84951487-84951509 AAAATATTGAAGCAAAATTGTGG - Intergenic
1071788187 10:88926419-88926441 CAAATAATTAAGTTAAAATGAGG + Intronic
1072814721 10:98494491-98494513 CAAATATTTAGGCTAAATTGTGG + Intronic
1073023222 10:100464820-100464842 CAAATGTTTAATTTAAATTGGGG - Intronic
1073848402 10:107586307-107586329 CAAATATTTAGGCTAAATTGTGG - Intergenic
1074599250 10:114897074-114897096 CAAATATTAAGGCTAAATTGTGG - Intronic
1074706146 10:116133646-116133668 CAAATATTTAGAATAAAATGTGG + Intronic
1075779638 10:125008836-125008858 CAAATATTTAGGCTAAATTGCGG - Intronic
1076430278 10:130397080-130397102 CAAATATTTAGGCTAAATTGTGG + Intergenic
1076565976 10:131399622-131399644 TGAATATTTAAGCTACATTGTGG + Intergenic
1076654695 10:132015944-132015966 CAAATATTTAGGCTAAATTGGGG + Intergenic
1076656856 10:132029996-132030018 CATGTATTTTGGCAAAATTGTGG + Intergenic
1077398371 11:2338682-2338704 CAAACATTTAGACTAAATTGTGG - Intergenic
1078045100 11:7906417-7906439 CAAATATTTAGGCTAAATTGTGG + Intergenic
1078073780 11:8138705-8138727 CAAATATTTAGGCTAAACTGTGG - Intronic
1078221866 11:9357987-9358009 CAAATATTTAGGCTAAATTATGG - Intergenic
1078399869 11:11016418-11016440 CAAAGATTTAGGTCAAACTGTGG + Intergenic
1080174525 11:29346001-29346023 CAAATTTATACGGTAAATTGGGG - Intergenic
1080962917 11:37181128-37181150 CAAATATTTAGGCTAAATTGTGG + Intergenic
1081239360 11:40683938-40683960 CATAGATTTATGCTAATTTGGGG - Intronic
1081778041 11:45690091-45690113 CAAATATTTAGGCTAAACTGTGG - Intergenic
1082941609 11:58711075-58711097 TAAATATTTAGGCTAAACTGTGG - Intronic
1083390065 11:62342311-62342333 CAAATATTTAGGCTAAATTGTGG + Intronic
1083539122 11:63499740-63499762 CAAATATTTAGGCTAAATTGTGG - Intergenic
1084048220 11:66583033-66583055 CAAGTATTTAGGCTAAATTGTGG + Intergenic
1084214007 11:67637684-67637706 CAAATATTTAGGCTAAATTGTGG + Intronic
1085812515 11:79697240-79697262 GAAATATTTAAGCTAAACAGAGG - Intergenic
1085918451 11:80921500-80921522 CAAATATTTAGGCTAAATTGTGG - Intergenic
1086767954 11:90722813-90722835 CAAATATCTAGGCTAAAATATGG + Intergenic
1087425221 11:97976662-97976684 AAAATATTTAGGCTAAATTGTGG + Intergenic
1087461636 11:98454897-98454919 CAAATATTTGGGTGAAATTCTGG + Intergenic
1087934980 11:104022649-104022671 CAAATATATATACTAAATTTTGG - Intronic
1088102862 11:106174210-106174232 CAAATGTTTAGGCTAAATTGTGG + Intergenic
1090818866 11:130322639-130322661 CAAATATTTAGGCTAAATTGTGG + Intergenic
1091076404 11:132622054-132622076 CAAACATTTAGGCCAAAATAAGG + Intronic
1091141222 11:133236646-133236668 CAAATATTTAGGCTAAATTGTGG - Intronic
1091467514 12:698091-698113 CAAATATTTAGGCTAAATTGTGG - Intergenic
1092569810 12:9709519-9709541 CAAATATTTGGGTGAAATTCTGG - Intergenic
1093076657 12:14765968-14765990 CAAATATTTAGGCTAAATTGTGG - Intergenic
1093369875 12:18354146-18354168 CAAATACTTGGGTTAAATTCTGG + Intronic
1094477151 12:30849933-30849955 CAAATATTTAGGCTAAATTGTGG + Intergenic
1095616545 12:44196967-44196989 CAAATCTGTAGGCTAATGTGCGG - Intronic
1096605144 12:52759811-52759833 CAAATAATTAGTCTAAACAGTGG + Intergenic
1097126486 12:56780399-56780421 CAAATATTTAGGTTAAATTGTGG - Intronic
1097747384 12:63316047-63316069 CAAATACTTTGGTTAAATTCTGG + Intergenic
1098711056 12:73762655-73762677 CAAATATTTAGGCTAAATTGTGG - Intergenic
1098714259 12:73809713-73809735 CAAAAATTTGGACTAAATGGTGG + Intergenic
1099212567 12:79810973-79810995 CAAATATTTATGCTATTTTAAGG + Intronic
1099450912 12:82805278-82805300 CAAATATTTAGGCTAAATTGTGG + Intronic
1099535027 12:83832792-83832814 CAAATATTAAGGTGAAACTGTGG + Intergenic
1099827960 12:87802979-87803001 CAAATATTTGGGGCAAATTCAGG + Intergenic
1100312771 12:93412855-93412877 CAAATATTTAGGCTAAATTGTGG + Intronic
1100419799 12:94421997-94422019 CAAATATCTAGGCCAAAAGGTGG - Intronic
1101216920 12:102594691-102594713 CAAATACTTGGGTTAAATTCTGG + Intergenic
1101455549 12:104826768-104826790 CAAATATTTGGGTGAAATTCTGG - Intronic
1102243522 12:111340706-111340728 CAAATATTTAGGCTAAATCGTGG - Intronic
1102478777 12:113206264-113206286 CAAATATCTAAGCTAAAATGTGG - Intronic
1103259669 12:119575633-119575655 CCAATATTAAGGCTAAAATTGGG - Intergenic
1103762349 12:123260176-123260198 CAAATATTTAGGCTAAATTGTGG - Intergenic
1104188355 12:126454270-126454292 GAAATATTTAGGCTAAATTGTGG + Intergenic
1105764115 13:23541629-23541651 CAAATATTTATGGTACATTATGG - Intergenic
1106076356 13:26464525-26464547 CAAATTTTCAGGCTAGATTCAGG - Intergenic
1106428927 13:29660603-29660625 CAAATATTTAAGCTAAATTGTGG + Intergenic
1106501988 13:30337699-30337721 CCAATATTCAGACAAAATTGAGG + Intergenic
1106779571 13:33044014-33044036 CAAATTTTTATGCAAGATTGGGG + Intronic
1106937317 13:34737454-34737476 CAGATATTCAGACTAAATTCAGG + Intergenic
1107205165 13:37776506-37776528 CATATATTGAGGCTCACTTGAGG + Intronic
1107229760 13:38094670-38094692 CAAATGTTTTGGCATAATTGGGG + Intergenic
1107513763 13:41109348-41109370 CAATTTTTTAGACTAAAGTGTGG + Intergenic
1108016583 13:46083099-46083121 CAAATATTTTAGCTGAATTCAGG + Intronic
1109440410 13:62364082-62364104 TAATTATTTAGGTTAAATTCAGG - Intergenic
1109449563 13:62492584-62492606 CAAATATGTTTGCTAAAATGTGG - Intergenic
1109481456 13:62961012-62961034 CAAATTTTTAGGATGAAGTGGGG + Intergenic
1109605287 13:64686618-64686640 CAAATATTTAGGCTAAATTGTGG - Intergenic
1109745174 13:66615080-66615102 CAAATATTTAGGCTAAATTGTGG + Intronic
1110094019 13:71492816-71492838 GAAATCTTAAGGCTTAATTGGGG - Intronic
1110517130 13:76427144-76427166 CAATTAGTTAGGCTAAGATGAGG - Intergenic
1110874806 13:80495522-80495544 CACATATTCAGACTAATTTGAGG + Intergenic
1111199268 13:84912850-84912872 GAAATATTTATGCAAAATAGAGG - Intergenic
1111586472 13:90289748-90289770 CAAATATTTAGGCTAAATTGTGG + Intergenic
1112519769 13:100084999-100085021 CAAATATTTATGCTAAATTGTGG + Intergenic
1112533705 13:100229469-100229491 CAAATATTTAGGCTAAATTGTGG - Intronic
1112929482 13:104716068-104716090 TGAATATTTAGGCTAAATTGTGG - Intergenic
1114511052 14:23261291-23261313 CAAATATTTAGGCTAAATTGTGG + Intronic
1114874788 14:26702101-26702123 CTGATATTTAGGCATAATTGGGG - Intergenic
1114925632 14:27394261-27394283 CAAATATTTAGGGGAGATTTGGG - Intergenic
1116240985 14:42342168-42342190 CAAATTTTAAGGCTGGATTGTGG + Intergenic
1116684657 14:48022574-48022596 CAAATATATAAGCTATATTTGGG + Intergenic
1117096364 14:52302594-52302616 AAAATATTAAGCATAAATTGGGG - Intergenic
1117180288 14:53184353-53184375 CAAATATTTAGGCTAAATTATGG + Intergenic
1118025697 14:61766164-61766186 CAAATATTTAGGCTAAATTGTGG - Intronic
1119135597 14:72215779-72215801 CAAATATTTAGGCTAAATTGTGG + Intronic
1120038601 14:79727230-79727252 TAAATAAGTAGACTAAATTGTGG - Intronic
1120179082 14:81324929-81324951 CACATTTTTAGGGTTAATTGAGG - Intronic
1120218293 14:81704452-81704474 TAAATATTTGGGGTAAATAGGGG + Intergenic
1121040300 14:90740841-90740863 CAGATATTTAGGTTAAAATCTGG - Intronic
1121083125 14:91124879-91124901 CAAATATTCAGGCTAAATTGTGG - Intronic
1122642196 14:103166442-103166464 CAAATACTTGGGTTAAATTCTGG - Intergenic
1123776543 15:23586207-23586229 CAAATATTTAGGCTAAATTGTGG - Intronic
1123792077 15:23732044-23732066 AAAATATATAAACTAAATTGTGG - Intergenic
1123832314 15:24153061-24153083 GAAATATTTAGGCTAAATTGTGG + Intergenic
1123838033 15:24216204-24216226 GAAATATTTAGGCTAAATTGTGG - Intergenic
1123847582 15:24318499-24318521 CAAATATTTAGGTTAAATTGTGG - Intergenic
1123866624 15:24525882-24525904 CAAATATTTAGGTTAAATTGTGG - Intergenic
1123881727 15:24683035-24683057 CAAATACTTAGGCTAAATTGTGG - Exonic
1124238285 15:28008329-28008351 CAAGTATTTAGGCTAAATTGTGG - Intronic
1124655762 15:31505354-31505376 CAAATATTTAGGCTAAATTGTGG + Intronic
1124656427 15:31512790-31512812 CAAATATTTAGGTTAAATTGTGG + Intronic
1125108091 15:35997495-35997517 CAAATATTTAGGCTAAATTGTGG - Intergenic
1126492188 15:49249787-49249809 CAAATATTTAGGCTAAATTGTGG - Intronic
1127950032 15:63795996-63796018 CAAATATTTAGGCTAAATTGTGG + Intronic
1128510312 15:68310321-68310343 CAAAGATTTAGGCTGGGTTGGGG - Intronic
1128573547 15:68753624-68753646 CAAATATTTAGGATAGTTAGAGG + Intergenic
1130879130 15:88040036-88040058 CAAATATTTAGGCTAAATTGTGG + Intronic
1131010295 15:89011895-89011917 CATATATTTAGGCTAAATTGTGG - Intergenic
1132112385 15:99111462-99111484 TGAATATTGTGGCTAAATTGTGG + Intronic
1133227981 16:4351580-4351602 CAAATATTTTGGCAAAATCAAGG - Intronic
1135229667 16:20694009-20694031 CAAATATTTAGGCTAAATTGTGG - Intronic
1135240745 16:20805615-20805637 CAAATATTTAGGCTAAATTGTGG - Intronic
1135291845 16:21246405-21246427 TAAATATTTAAGCTAAATTGTGG + Intronic
1136638832 16:31544607-31544629 CAAATATTTAGGCTAAATTGTGG - Intergenic
1137039304 16:35595277-35595299 CAGATATTCAGGCTAAAATGTGG + Intergenic
1137039873 16:35600532-35600554 CAAATATTTAGGCTAAATTCTGG + Intergenic
1137517734 16:49163017-49163039 CAAATATTTATTGTAAAATGAGG - Intergenic
1138687257 16:58736293-58736315 CAAATATTTAGGCTAAATGGTGG - Intergenic
1138795699 16:59965861-59965883 CAAATATTTAAGCTCAATTGTGG + Intergenic
1140864941 16:79051859-79051881 CAAATATTTAGGCTAAACTGTGG - Intronic
1142235236 16:88919032-88919054 CAGATACTTAGGCTAAATTGTGG - Intronic
1142318179 16:89362708-89362730 CAGATACTTAGGCTAAATTGTGG - Intronic
1142322354 16:89391893-89391915 CAGATATTTAGGCTAAATTGTGG - Intronic
1142441282 16:90099458-90099480 CAAATATTTAGGCTAAATTGTGG - Intergenic
1143999930 17:11044302-11044324 CAAATATTCAGGCTAAACTGTGG - Intergenic
1145285337 17:21501663-21501685 CAAATAGATAATCTAAATTGAGG - Intergenic
1145392184 17:22464077-22464099 CAAATAAATAATCTAAATTGAGG + Intergenic
1146248817 17:31318043-31318065 AAAATTTTAAGGATAAATTGAGG - Exonic
1146886249 17:36472946-36472968 CAAATACTTGGGTTAAATTCTGG + Intergenic
1148177155 17:45576787-45576809 CAAATATTTAGGCTAAATTGTGG - Intergenic
1148516778 17:48226302-48226324 CAAATACTTCTGCTAAATGGAGG - Intronic
1151029993 17:70725865-70725887 CAAATATTTTTGCAAAATTAAGG + Intergenic
1155369919 18:25088147-25088169 CAGGTATTTAGCCTAAAATGAGG - Intronic
1155434119 18:25793297-25793319 CAAACATTTGGGCTAAAGTTAGG - Intergenic
1155574666 18:27231647-27231669 CAAATATTTAGGCTAAATTGTGG + Intergenic
1155938146 18:31775723-31775745 CAAATATTTAGGCTAAATTGTGG - Intergenic
1156610677 18:38720270-38720292 CAAATATTTAGGCTAAATTGTGG - Intergenic
1156828342 18:41460924-41460946 CAAATATTTATGAACAATTGTGG - Intergenic
1156835712 18:41551370-41551392 AAAATATTTAATATAAATTGTGG + Intergenic
1157789137 18:50515285-50515307 CCAATTTTTAGGCTCAATTTGGG - Intergenic
1158807845 18:60996797-60996819 CACATTTATAGGATAAATTGAGG + Intergenic
1159497341 18:69223018-69223040 CAAATATGTAGGCTACAGAGGGG + Intergenic
1159687648 18:71443241-71443263 CAGATATTTATTCTAAATTCAGG + Intergenic
1160655440 19:265085-265107 CAAATATTTAGGCTAAATTGTGG - Intergenic
1160700718 19:505910-505932 CAGATATTTAGCCTACATTGTGG + Intergenic
1162237563 19:9321132-9321154 CAAATATTTAGGCTAAATTGTGG + Intergenic
1162265988 19:9574785-9574807 CAAATATTTAGGCTAAATTGTGG + Intronic
1162271840 19:9622060-9622082 CAAATATCTAGGCTAAAATGTGG + Intronic
1162271908 19:9622779-9622801 CAAATATGTAGACTAAACTGTGG + Intronic
1162288433 19:9759298-9759320 GAATTATTTAGACTAAATTATGG + Intronic
1162652214 19:12098285-12098307 CAAGTATTTAGGCTAACTTGTGG + Intronic
1163210716 19:15837743-15837765 CAAATATTTGGGCTAAATTGTGG + Intergenic
1163922953 19:20310125-20310147 CAAATATTTAGGCTAAATTATGG + Intergenic
1163927285 19:20357805-20357827 CAAATATTTAGGCTAAACAGTGG + Intergenic
1163946291 19:20538241-20538263 CAAATATTTAGGCTAAATTGTGG - Intronic
1163973099 19:20819581-20819603 CAAATATTTAGGCTAAATTGTGG + Intronic
1163984866 19:20936745-20936767 CAAATATTTAGGCTAAAATGTGG + Intronic
1164523052 19:28993458-28993480 CAAATATTTAGGCTAAATTGTGG - Intergenic
1165109224 19:33491845-33491867 CAAATATTTAGGTTAAATTGTGG + Intronic
1165251832 19:34544799-34544821 CAAATATTAATGAAAAATTGAGG - Intergenic
1165294769 19:34917661-34917683 CAAATATTTAGGCTAAATTGTGG + Intergenic
1166411640 19:42559531-42559553 CAAATATTTAGGCTAAATTGTGG + Intronic
1166496792 19:43308751-43308773 CAAATATCTAAGCTAAAATGTGG + Intergenic
1166908559 19:46133598-46133620 CAAATATCTAGGCTAAAATGCGG + Intergenic
1167319530 19:48787766-48787788 CAAATATTTAGGGTAAATTGTGG + Intergenic
1167335467 19:48882812-48882834 CAAATATTTAGGGTAAATTGTGG + Intronic
1167838748 19:52096535-52096557 CAAATATCTAGGCTAAAATGTGG - Intergenic
1168175980 19:54628266-54628288 CAAATATTTAGGCTAAATTGTGG + Intronic
1168611637 19:57805248-57805270 CAAATATTTAGGCTAAATTGTGG + Intronic
1168626055 19:57918934-57918956 CAAATATTTAGGCTAAATTGTGG - Intergenic
1168642980 19:58042081-58042103 CAAATATTTAGGCTAAATTGTGG + Intronic
925229395 2:2219525-2219547 CAAATATTTAGGCTAAATTGTGG - Intronic
925572671 2:5328808-5328830 AAATTAATTAGGTTAAATTGGGG - Intergenic
925660313 2:6195354-6195376 CAAATATTTAGGCTAAACTGTGG + Intergenic
925822690 2:7815982-7816004 CAAATAAATAAGCTAAGTTGTGG + Intergenic
925900630 2:8506903-8506925 CAAATATTTATGCAAAACTCTGG + Intergenic
926853211 2:17223726-17223748 CAAATATAAAGGCTAAAGTTGGG - Intergenic
929421014 2:41789588-41789610 CAAATATTTAGGACCTATTGTGG - Intergenic
929929987 2:46246546-46246568 CAAATATTTAGGCTAAATTGTGG + Intergenic
930455905 2:51606901-51606923 GAAATATTTTGGCTAAACAGAGG + Intergenic
930650759 2:53962096-53962118 CAAATATTTAGGCTAAATTGTGG + Intronic
930787024 2:55281146-55281168 CAAATATTTAGGCTAAATTGTGG + Intergenic
931451768 2:62373343-62373365 CAAATATCTAGGCTAAAATATGG + Intergenic
931809443 2:65840522-65840544 CAGAGATTTAGGCTCAATTCAGG + Intergenic
932088729 2:68785955-68785977 TAAATATTTGGGCATAATTGGGG - Intronic
933718259 2:85378101-85378123 CAAATATTTAGGCTAAATTGTGG + Intronic
935044727 2:99470527-99470549 CAAATATTTAGGCTAAATTGTGG - Intronic
935330289 2:101972531-101972553 CAAATATTTAGGCTAAATCGTGG + Intergenic
935787190 2:106559899-106559921 CAAATATTTAGGCTAAACTGTGG - Intergenic
935954755 2:108364781-108364803 CAAATATCTAGGCTAGAATGTGG - Intergenic
936891613 2:117377204-117377226 CAAATTTTTATAATAAATTGTGG - Intergenic
937726563 2:125174302-125174324 GCAAAATTTAGGCTAAATTGTGG - Intergenic
938126922 2:128681066-128681088 CAAACACTTAGGCTAAATTATGG - Intergenic
938480873 2:131660268-131660290 CAAATATTTTGCCTAAACTCAGG - Intergenic
938747617 2:134294715-134294737 CAAATATTTAGGCTAAATTGTGG - Intronic
939505165 2:143036550-143036572 CAAATATTTAGGCTAAATTGTGG + Intronic
939600636 2:144185536-144185558 CCTATATTTAGGATAAATTAAGG - Intronic
940154010 2:150633797-150633819 CAAATATTTGAGCTATATGGAGG + Intergenic
941186409 2:162325799-162325821 CAAATATTTAGGTGAAATTCTGG + Intronic
941760787 2:169240727-169240749 CAAAAAATGAGACTAAATTGAGG - Intronic
943383350 2:187175938-187175960 CAAATACTTGGGTTAAATTCTGG + Intergenic
943441483 2:187932711-187932733 CAAATACTTGGGTTAAATTCTGG + Intergenic
943633417 2:190279702-190279724 CAAATATTTAGGCTAAATGTGGG - Intronic
943747380 2:191476353-191476375 CAAATATTTATGCAAACTTGTGG + Intergenic
943919535 2:193686198-193686220 TTAAAATTAAGGCTAAATTGTGG + Intergenic
944240807 2:197483400-197483422 CAAATATTTAGGCTAAATTGTGG - Intergenic
945191374 2:207191185-207191207 CAAATATGTAGGATAAATTAAGG + Intergenic
945489997 2:210443350-210443372 CAAATTTATAGGCTAATTTAGGG - Intronic
945607744 2:211957210-211957232 GAGGTAATTAGGCTAAATTGAGG + Intronic
945726282 2:213475166-213475188 CAAATACTTGGGTTAAATTCTGG + Intronic
946081081 2:217118950-217118972 GAACTATTTAGGCTGAATTAAGG + Intergenic
946883430 2:224199032-224199054 CAAATATTTAGGCTAAATTGTGG - Intergenic
947128238 2:226894725-226894747 AAAATATTTAGGCTATAAGGTGG + Intronic
947562607 2:231170493-231170515 CAAGTATTTACTCTAGATTGTGG + Intronic
947996544 2:234532708-234532730 CAAATATTTAAGCTAAATTGTGG - Intergenic
1169438424 20:5613638-5613660 CAAATATCTTGACTAAATGGTGG - Intergenic
1169906084 20:10605447-10605469 AAAATATTTAGGAAAAATGGAGG - Intronic
1170709433 20:18776993-18777015 AGCATATTTAGGCTAAATTGTGG - Intergenic
1172092117 20:32440623-32440645 CAAATATTCAGTCTAAACTCAGG - Intergenic
1176924145 21:14726294-14726316 CTAATATTTTGGCTATATTAAGG + Intergenic
1177604284 21:23358545-23358567 CAGATATTTAGGGGAAATTGTGG + Intergenic
1177658458 21:24050685-24050707 CAAAAAAAAAGGCTAAATTGTGG + Intergenic
1178014786 21:28331840-28331862 GAAATATTTAGGGTCAAATGTGG + Intergenic
1178619861 21:34164784-34164806 CAAATATTTAGGCTAAACTGTGG + Intergenic
1178862663 21:36302168-36302190 CAAATATTTAGGCTAAATTGTGG + Intergenic
1179016293 21:37596680-37596702 CAAATATTTAGGCTAAATTGTGG - Intergenic
1179317612 21:40258642-40258664 CAGATATTTAAGCTAAATTGTGG - Intronic
1179918317 21:44492675-44492697 CAAATACCTAGACTAAAATGTGG - Intergenic
1180659674 22:17455209-17455231 CAAATAATTAGGCTAAGTTGTGG + Intronic
1180673079 22:17568510-17568532 CAAATATTGAGGCTAAACTGTGG + Intronic
1181381790 22:22510345-22510367 CAAATATTTAGGCTAAATTGTGG + Intergenic
1181940984 22:26476736-26476758 CAAAGACTTAGGCCAACTTGTGG - Intronic
1182729004 22:32472505-32472527 CAAATATTTAGGCTAAATTGTGG - Intergenic
1182923300 22:34099804-34099826 CAAATATTTAGGCTAAATTGTGG - Intergenic
1183048844 22:35244542-35244564 CAAATATTTAGGCTAAACTGTGG - Intergenic
1183596343 22:38814761-38814783 CAAATAAATAGGCTCAATTCCGG - Intergenic
1185401720 22:50622257-50622279 CAGATATTTAGGCTAAATTGTGG + Intergenic
949093011 3:51499-51521 CAAATATTTAGGCCAAATTGTGG - Intergenic
949726866 3:7058978-7059000 CAAATATTTAGGCTAAACTGTGG + Intronic
950084128 3:10245173-10245195 CAAATATTTAGGCTAAATTGTGG - Intergenic
950241819 3:11377233-11377255 GAATTATTTTGGTTAAATTGTGG + Intronic
951352520 3:21623821-21623843 CAAATAGTCATGGTAAATTGGGG - Intronic
951788592 3:26453175-26453197 CATATATATAGGCAAAATGGAGG - Intergenic
952003201 3:28810045-28810067 CAAATATTTGGGTGAAATTCTGG + Intergenic
952684260 3:36131217-36131239 CAAATACTTGGGTTAAATTCTGG - Intergenic
953723143 3:45373825-45373847 CAAATATTTAAGCTAAATTGTGG - Intergenic
953800017 3:46015741-46015763 CCAATAGTAAGGTTAAATTGGGG - Intergenic
954588152 3:51754750-51754772 CAAATATTTAGGCTAAATTGTGG + Intergenic
955417274 3:58704409-58704431 CAAATATTTAGGCTAAATTGTGG - Intergenic
955615476 3:60802581-60802603 CAAATATTGAGGCAAAATCGAGG - Intronic
956557754 3:70541227-70541249 CAAATACTTGGGTTAAATTCTGG + Intergenic
957033274 3:75267598-75267620 CAAATATTTAGGCCAAATTGTGG - Intergenic
957716459 3:83935111-83935133 CAAATATGTTGCCTGAATTGTGG + Intergenic
957769160 3:84666415-84666437 CAAATATTAAGGCTAAAAATGGG + Intergenic
958032218 3:88125640-88125662 CAAATATATAATCTAAATCGTGG - Intronic
958213759 3:90531536-90531558 TAAATATTTAGGCTTTTTTGGGG - Intergenic
958632675 3:96702256-96702278 CAAATATTTGGGAGAAATTCTGG - Intergenic
958762697 3:98327930-98327952 CAAATATTTAGGCTAAATTGTGG + Intergenic
959455707 3:106558273-106558295 AAAATATTTAGGATAATATGAGG + Intergenic
959840037 3:110964869-110964891 CAAATATCTAGGCTAAAATGTGG + Intergenic
959840649 3:110970109-110970131 CAAATATCTAGGCTAAAATGTGG + Intergenic
959892904 3:111576654-111576676 CAACTATGTAGAATAAATTGAGG - Intronic
960398356 3:117165458-117165480 CAGTTATTTAGGTTAAAATGAGG - Intergenic
960625209 3:119675537-119675559 AAAATATTTATGCTAAATGAAGG + Intronic
960728139 3:120692504-120692526 TAAATCTTTATGCTAAATTCTGG + Intronic
961343326 3:126245070-126245092 CAAATATTTGGGTGAAATTGTGG + Intergenic
961361156 3:126368228-126368250 CAAATATTTATGTTGAATAGTGG + Intergenic
963427479 3:145150250-145150272 CAAATATTGAGGCTAGAAAGTGG + Intergenic
964159802 3:153633282-153633304 CATATAATTAGGTTAAACTGGGG + Intergenic
965206686 3:165728231-165728253 AAAAAATGTAGGTTAAATTGAGG - Intergenic
965300451 3:167000162-167000184 CAAATACTTGGGTTAAATTCTGG + Intergenic
967231448 3:187341343-187341365 CAAATATGTATTGTAAATTGGGG - Intergenic
967712272 3:192723164-192723186 TAAATATTTAGGGTAATTGGGGG + Intronic
967931920 3:194696124-194696146 CAAATATTAAGGCTATTTTTAGG + Intergenic
967962198 3:194934781-194934803 CATATATTTAGGCCAAGCTGGGG - Intergenic
968140842 3:196255219-196255241 CAAATTTATAGGCTAATTTGTGG + Intronic
968294100 3:197560281-197560303 CAAATATTTAGGCTAAATTGTGG - Intronic
968361539 3:198150434-198150456 CAAATATTTAGGCTAAATTGTGG - Intergenic
968455207 4:694467-694489 CAAATATTTAGGCTAACTTGTGG - Intergenic
968769446 4:2494831-2494853 TAAATATTTAGGCTAAATTGTGG + Intronic
969084283 4:4644037-4644059 CAAATATTTAGGCTAAATTGTGG + Intergenic
969689007 4:8694037-8694059 AAAATAGTGAGGCTAAAATGAGG - Intergenic
969899847 4:10338763-10338785 AAAATATGAAGGCTAAAATGAGG - Intergenic
970299887 4:14670069-14670091 CAGCTATTTAGGCTAAATCAAGG - Intergenic
971190111 4:24419890-24419912 CAAATATTGAGTCTAAATCCAGG + Intergenic
971535978 4:27751960-27751982 CAAATATTAACTCTAAATAGTGG + Intergenic
971600497 4:28585650-28585672 CAAACATTTAGGCTACATTGTGG - Intergenic
971638142 4:29090911-29090933 AAAATATGTAGCCAAAATTGAGG + Intergenic
971723896 4:30283408-30283430 CAAATATTTAGGCTAAATTGTGG - Intergenic
971997590 4:33985330-33985352 CAAGTATATTGGCTAAATTGTGG - Intergenic
972052748 4:34759684-34759706 CAAATATTTTGGATAAATGTTGG + Intergenic
972802018 4:42486371-42486393 CAAATATTTAGGCTAAATTGTGG + Intronic
972918228 4:43905686-43905708 CAAATATTTGGGTAAAATTCTGG - Intergenic
973244138 4:47991976-47991998 CAAGTATTTAGGCTTATTTCTGG + Intronic
973857269 4:55025529-55025551 CAAATATTTAGGCTAAATTGTGG - Intergenic
974250287 4:59376357-59376379 CAAATATTTGGGTGAAATTCTGG + Intergenic
974621687 4:64363723-64363745 CAAATATTTAGGCTAAAGTGTGG + Intronic
974973809 4:68865222-68865244 CAAATATTTACACTAAATTGTGG - Intergenic
974980787 4:68954973-68954995 CAAATATTTAGGCTAAATTGTGG - Intergenic
975347505 4:73310036-73310058 AAAATATTTTATCTAAATTGTGG + Intergenic
975659130 4:76671062-76671084 CAAATAAATAGGCTAAACTAGGG - Intronic
975691943 4:76974118-76974140 CAATTCTTTAGGCTCAAATGAGG - Intronic
975905482 4:79206506-79206528 CAAATATTTAGGCTAAATTGTGG - Intergenic
976170061 4:82294296-82294318 CAAATATTCAGGATGAGTTGGGG - Intergenic
977451447 4:97203950-97203972 GAAATATTTAGGCTAAATAGAGG + Intronic
977674148 4:99729813-99729835 GAGATATTTGGTCTAAATTGAGG - Intergenic
977988373 4:103412872-103412894 CAAATATTTAGGCTAACTTGTGG + Intergenic
978253626 4:106665519-106665541 TAAATATTTATGATAAATTTAGG - Intergenic
978366422 4:107987924-107987946 CAAATATTTAGGCTAAATTGTGG - Intergenic
978369109 4:108012718-108012740 CAAATATTTAGGCTAAATTGTGG + Intronic
979100534 4:116606496-116606518 CAAATATTTAGGCTAAATTGTGG + Intergenic
979188906 4:117833512-117833534 CAAATATTTGGGTGAAATTCTGG + Intergenic
979575186 4:122282308-122282330 CCAATTCTTAGGCTATATTGTGG - Intronic
980004823 4:127529993-127530015 CAAATATTTAGGCTAAATTATGG - Intergenic
980414578 4:132468375-132468397 CAAATTTTCAAGCTAAATTTTGG + Intergenic
981427406 4:144619431-144619453 CAAATATTTCTGCTAATGTGAGG - Intergenic
981592300 4:146377048-146377070 CAAATATTTAGGCTAAATTGTGG + Intronic
981816574 4:148837700-148837722 CAAATACTTAGGCTAAGTTATGG - Intergenic
982611241 4:157576066-157576088 CTAATATTAAGGGTAATTTGAGG + Intergenic
984015616 4:174422598-174422620 CAAATATTTGGGTTTAGTTGAGG - Intergenic
984109255 4:175591123-175591145 CAAATTTGTAGACTAAATTGAGG + Intergenic
984333402 4:178356363-178356385 CACAAATCTAGGCTACATTGAGG + Intergenic
984940031 4:184922894-184922916 CAAATATTTAGGCTAAATTGTGG - Intergenic
985238425 4:187902300-187902322 CAAATATTTAGGCTAAACTGTGG + Intergenic
986160973 5:5228839-5228861 CAAATATTCAGGCTAAAATGTGG - Intronic
986454189 5:7899216-7899238 CAAATCTTTATGTTAAAATGTGG - Intronic
986585651 5:9314434-9314456 AAAATATTTTGGATATATTGAGG + Intronic
986849923 5:11799097-11799119 CAAATCTTTAGTATGAATTGAGG - Intronic
987674449 5:21056958-21056980 CAAATATTTAGGTAACATTAAGG - Intergenic
987739835 5:21893240-21893262 CAACTATTTAGTCTAAGTTGTGG + Intronic
988604360 5:32667257-32667279 CAAATACTTGGGTTAAATTCTGG + Intergenic
989821009 5:45795949-45795971 CAAATACTTTGGTTAAATTCTGG - Intergenic
990895634 5:60697816-60697838 ATAATATTCAGGCTAAATTTAGG - Intronic
991090745 5:62691485-62691507 CAAATATTTAGGCTAAATTGTGG + Intergenic
991192155 5:63887277-63887299 CAAATATTTAGGCTAAATTGTGG - Intergenic
991955602 5:71992756-71992778 CAAATCTCTAGATTAAATTGGGG - Intergenic
993179928 5:84539703-84539725 CAAATATTTAGGCTAAATTGTGG - Intergenic
993202494 5:84834204-84834226 TAAATATTTAGGCTAAATTGTGG - Intergenic
994153546 5:96476470-96476492 AAAATATTTAGGCAGAACTGTGG + Intergenic
995416025 5:111914333-111914355 CAAATATTTAGGGTAAAATGTGG - Intronic
995960803 5:117836691-117836713 CAAATATTTAAGCTTAATGCAGG - Intergenic
996056197 5:118985256-118985278 CTAATATTTAGGATTAATTAGGG - Intronic
996467241 5:123817208-123817230 CAAATTTCTAGGTTAAATTCAGG + Intergenic
996511468 5:124321287-124321309 CAAAAATTCAGGATAAATTTTGG + Intergenic
996717518 5:126599956-126599978 CAAATATTTAGGCTAAATTGTGG - Intergenic
996921578 5:128773984-128774006 TAAATATTTAGGTTAAAGTGGGG - Intronic
996990169 5:129620412-129620434 AAAATATTTACCTTAAATTGGGG + Intronic
997408542 5:133671865-133671887 CAAATATTTAGGCTAAATTGTGG + Intergenic
997534989 5:134612976-134612998 CAAATATTTAGGCTAAATTGTGG - Intronic
998859988 5:146433111-146433133 CAAATATTTAGGCTAAATGTGGG + Intergenic
998964386 5:147523407-147523429 CAAATATTTATGCCATATTGAGG + Intergenic
999347010 5:150832352-150832374 CAAATATTTAGGCTAAATTGTGG + Intergenic
999580544 5:153033590-153033612 CAAATATTTAGGCTAAATTGTGG + Intergenic
999833822 5:155347747-155347769 CAAATATTTAGGCTAAACTGTGG - Intergenic
1000327918 5:160186333-160186355 CAAATATCTAGGCTAAAATGTGG - Intergenic
1000852802 5:166361631-166361653 CAAATATTTAGTCTATAAGGTGG + Intergenic
1001467399 5:171980098-171980120 CAAATACTTAAGCTAAATTGTGG + Intronic
1002207750 5:177575427-177575449 CAAATATTTAGGCTAAATTGTGG + Intergenic
1002843143 6:923078-923100 CAAATATTTGGGTGAAATTCTGG - Intergenic
1003475616 6:6479405-6479427 CAGATATTTAGGCTAAATTGTGG + Intergenic
1003997520 6:11557792-11557814 GAAATATTTAGGAGAACTTGCGG - Intronic
1004305243 6:14495497-14495519 CAAATATTTAAAATAAGTTGTGG - Intergenic
1004525804 6:16406637-16406659 TAAATATTTAGGCTAAATTGTGG - Intronic
1005360330 6:25025055-25025077 CAAATATTCACACTAAATGGAGG + Intronic
1006412220 6:33880711-33880733 CAAATATTTAGGCTAAATTGTGG - Intergenic
1007580262 6:42954495-42954517 CAAATATTTAGGCTACATTGTGG - Intergenic
1008205021 6:48644548-48644570 TAAGTATTTAGGCAGAATTGTGG - Intergenic
1009725337 6:67530745-67530767 CAAATATTTAGATAAAATTCTGG + Intergenic
1010533088 6:76991041-76991063 CAAATATTTGGGTGAAATTCTGG - Intergenic
1010732692 6:79407703-79407725 CATATATTTATGCTACATTAGGG - Intergenic
1011426178 6:87233749-87233771 TAAATGCTTTGGCTAAATTGTGG + Intronic
1012107281 6:95179043-95179065 CACACATTTAGGCTAATTGGTGG + Intergenic
1014110482 6:117615441-117615463 CAAATATTTAGGCTAAATTGTGG - Intergenic
1014111357 6:117621584-117621606 CAAATATTTAGGCTAAATTGTGG - Intergenic
1014328849 6:120034365-120034387 AAAATATTTAGTCAACATTGAGG + Intergenic
1015006767 6:128291836-128291858 CACATATTTATGCTACAGTGTGG + Intronic
1016120644 6:140338328-140338350 CAAATACTTGGGTTAAATTCTGG + Intergenic
1016582722 6:145647261-145647283 CAAATATCTGCCCTAAATTGAGG - Intronic
1016700077 6:147044438-147044460 CAAATATCTAGGCTAAAATGTGG + Intergenic
1016911037 6:149199556-149199578 AAAATATTTAAGCTTAAATGAGG + Intergenic
1017293833 6:152771704-152771726 CAAGTATTTGGGCCAAATTTAGG + Intergenic
1018136955 6:160788282-160788304 CAAATATTTAGTCTAAATTGTGG - Intergenic
1018193410 6:161331863-161331885 CAAATACTTAGGCTAAATTGTGG - Intergenic
1018949006 6:168366275-168366297 CAACTATTTAGGCTAAATTGTGG - Intergenic
1019042746 6:169120016-169120038 CAAATACTGAGGTTAAATTCTGG - Intergenic
1019254146 7:38286-38308 CAAATATTTAGGCTAAATTGTGG + Intergenic
1019946754 7:4335867-4335889 CAAATATTTAGGCTAAATTGTGG + Intergenic
1020580045 7:9985917-9985939 GAAATATTTGAGCTAAATTTTGG - Intergenic
1020673603 7:11151975-11151997 AAAATATTTAGGATTTATTGTGG - Intronic
1021722029 7:23513998-23514020 CAAATACTTAGGCTAAATTGTGG + Intronic
1022623842 7:32013697-32013719 CAAATATTTTGGCTAAATTGTGG + Intronic
1023756262 7:43420111-43420133 CAAATATTTAGGCTAAATTGTGG + Intronic
1024264912 7:47599009-47599031 CAAATATTTGGGTGAAATTCTGG - Intergenic
1024619812 7:51147695-51147717 CAAATATTTAGGCGAAATTGCGG + Intronic
1024843914 7:53620080-53620102 CAAATATTTAGGCTAAATTGTGG + Intergenic
1026066250 7:67075983-67076005 AAAATATTTAGGCTAAATTGTGG - Intronic
1026288168 7:68982111-68982133 TAAATATTTAGGCTAAATTGTGG - Intergenic
1026710679 7:72736355-72736377 CAAATATTTAGGCCAAATTGTGG + Intronic
1027889322 7:83950604-83950626 CAATGATATAGGGTAAATTGGGG - Intergenic
1028163543 7:87512304-87512326 GAAAGATTTAGGTTAAATTGTGG - Intronic
1030207803 7:106967585-106967607 CAAATATTTAGGCTAAATTGTGG - Intergenic
1030373060 7:108722206-108722228 CAAACGTTTAGGCAAAAATGAGG - Intergenic
1030386915 7:108876494-108876516 CAAATATTTGGGTTGAATTCTGG - Intergenic
1030473423 7:109997591-109997613 CAAATATCCAGGCGAAATTTTGG - Intergenic
1030564077 7:111129942-111129964 GAAATGTTTAGGCCAAATTTTGG - Intronic
1032917804 7:136511447-136511469 CAAATAATTTGGTTAAATTCTGG + Intergenic
1032937669 7:136752160-136752182 CAAATATTTAGGCTAAATTGTGG - Intergenic
1033371007 7:140707615-140707637 CATATATTTAAACTAAATAGTGG + Intronic
1034585004 7:152082579-152082601 CAGATATTTAGGCTAAAGTGTGG + Intronic
1034766325 7:153724827-153724849 CATATATTCAGGCTGAGTTGTGG + Intergenic
1035133853 7:156680642-156680664 CAATTATTGATGCTACATTGTGG + Exonic
1036517643 8:9459402-9459424 CAAATATTTAGGGGTAATTTGGG - Intergenic
1037001740 8:13728013-13728035 GAAATATTAAGGCAAAATTATGG + Intergenic
1037130881 8:15406429-15406451 CAAATATTTAGGCTAAATTGTGG + Intergenic
1037514376 8:19616158-19616180 TGAATATTTAAGATAAATTGAGG - Intronic
1038525120 8:28266436-28266458 CAAATATTTAGGCTAATTTGTGG + Intergenic
1038821216 8:30953536-30953558 GAAATAATTATGTTAAATTGAGG + Intergenic
1038958001 8:32488164-32488186 AAAATATTTAGGCGAAATAATGG - Intronic
1039045771 8:33448007-33448029 CAAATATTCAGGTTTAATTATGG + Intronic
1039699483 8:39947398-39947420 AAAATATTTAGGCTAAATTGTGG - Intronic
1039799724 8:40943722-40943744 CAAATATTTAGGCTAAACTGTGG + Intergenic
1039961771 8:42254026-42254048 CAAATATTTAGGCTAAATTGTGG + Intergenic
1040848868 8:51877468-51877490 CAAATATTTAGGCTAAATTGTGG + Intronic
1041066599 8:54088155-54088177 CAAATATTTAGGCTAAATTGAGG + Intronic
1041514079 8:58681169-58681191 CAAATATTTCTTCCAAATTGTGG - Intergenic
1042102567 8:65289206-65289228 GTAATATTTACACTAAATTGTGG - Intergenic
1042841608 8:73129891-73129913 CAAATATTTAGGCTAAATTGTGG - Intergenic
1043022486 8:75021494-75021516 CAAGTATGTAGGATAATTTGAGG + Intronic
1044008465 8:86964506-86964528 CAAATAGTTAGGTTAAGTTCTGG + Intronic
1044338309 8:91015957-91015979 CAAATATTTAGGCTAAATTGTGG + Intronic
1045178414 8:99752580-99752602 CAAATATTTAGGCTAGATCTAGG - Intronic
1045593136 8:103621523-103621545 CAAATATTTAGGCTAAACTGTGG + Intronic
1045963907 8:108001323-108001345 GAATTGTTTATGCTAAATTGAGG - Intronic
1046138719 8:110062595-110062617 CAAATATTTGGGTGAAATTCTGG - Intergenic
1046850875 8:118971469-118971491 TAAAAAATTAGGCTATATTGAGG - Intergenic
1047126909 8:121972878-121972900 CATCTTTTGAGGCTAAATTGAGG + Intergenic
1047246528 8:123150174-123150196 ACAATATTTAAGCAAAATTGTGG + Intronic
1047665939 8:127091202-127091224 CAAATATTTAGGTTAAATTGTGG - Intergenic
1047973216 8:130104314-130104336 CAAAGATTCAGGCTAAATTTTGG - Intronic
1049391055 8:142371787-142371809 CAAATTTTTAGCCTAAGCTGAGG + Intronic
1049461802 8:142733285-142733307 CAAATATTTAGGCTAAATTGTGG + Intronic
1050999515 9:12263887-12263909 TAAATATTTATTATAAATTGAGG + Intergenic
1051155063 9:14133740-14133762 CAACTATTAAGGCCAGATTGGGG + Intronic
1052615001 9:30826975-30826997 CAAATCTTCACGCAAAATTGTGG - Intergenic
1053062221 9:35041234-35041256 CAAATATTTAGGCTAAATTGTGG + Intronic
1054198594 9:62059055-62059077 TAAATCTTTAGTTTAAATTGAGG + Intergenic
1054639761 9:67529310-67529332 TAAATCTTTAGTTTAAATTGAGG - Intergenic
1055392575 9:75839018-75839040 CAAATATTTGGTTAAAATTGGGG - Intergenic
1055924971 9:81500428-81500450 CAAATCTTTAGGGAAAATTGAGG - Intergenic
1056373151 9:85979466-85979488 CAAATATTTAGGCTAAATTCTGG + Intronic
1056920340 9:90782189-90782211 CAAATATTTAGGCTAAATTGTGG + Intergenic
1057532587 9:95864927-95864949 CAAAAATTTTGGCTAAAACGTGG - Intergenic
1057615091 9:96582314-96582336 CAAATATTTAGGCTAAATTGTGG - Intronic
1058442039 9:105018296-105018318 AAAATATTTCTGATAAATTGGGG - Intergenic
1059200800 9:112414114-112414136 CAAATATTTAGGCTAAATTGTGG + Intronic
1059818451 9:117945000-117945022 CAAATATTTAGGCTACATTGTGG + Intergenic
1061501449 9:131005302-131005324 CAAATATTTAGGCTAAATTGTGG - Intergenic
1062746257 9:138214255-138214277 CAAATATTTAGGCTAAATTGTGG - Intergenic
1185513948 X:684375-684397 CAAATATTTAGGCTAAATTGTGG + Intergenic
1185703772 X:2251324-2251346 CTGATACTTAGGTTAAATTGTGG - Intronic
1186179404 X:6958357-6958379 CAAATATTTAGGCTAAATTGTGG + Intergenic
1187042041 X:15607036-15607058 CAAATATTTAGGTTAAATTGTGG - Intergenic
1187385502 X:18844788-18844810 CAAATATTTAGGCTAAATTGTGG + Intergenic
1188157447 X:26756997-26757019 CAAATATTTAGGCTAAATTGTGG - Intergenic
1188207260 X:27375761-27375783 CAAATATTTAGGCTAAATTGTGG - Intergenic
1188688442 X:33099033-33099055 CAAATATTTAGGCTAAATTGTGG + Intronic
1188878503 X:35462430-35462452 CAAATATTTAGAGTAAATTGTGG - Intergenic
1189414672 X:40803559-40803581 CAAATATTTGGGTGAAATTGTGG + Intergenic
1189416904 X:40823294-40823316 CAAATACTTAGGCTAAATTGTGG - Intergenic
1189516730 X:41719896-41719918 CAAATATTTAGGCTAAATTGTGG + Intronic
1189620635 X:42833707-42833729 CAAATATTTAGGCTAAATCGTGG - Intergenic
1189665453 X:43350378-43350400 CAAATATTTAGGCTAAATTGTGG - Intergenic
1189964660 X:46360170-46360192 TAAATATTTAGGCTAAATTGTGG + Intergenic
1190136287 X:47801959-47801981 TAGATATTTGGTCTAAATTGGGG - Intergenic
1191846920 X:65553781-65553803 CAAATATTTAGGCTAAATTGTGG - Intergenic
1192319461 X:70077836-70077858 CAAATATTTAGGCTAAATTGTGG + Intergenic
1193574722 X:83183843-83183865 CAAATATTTGGGGTAAGTTCTGG + Intergenic
1193718466 X:84959352-84959374 CAAATATTTAGGCTAAATTTTGG - Intergenic
1193812565 X:86068761-86068783 CAAATATTTAGGCTAAATTGTGG - Intergenic
1193845166 X:86460203-86460225 CAAATATTTTGGAAAAAATGTGG + Intronic
1194198206 X:90922747-90922769 CAAATATTTAGGCTAAATTGTGG - Intergenic
1194369323 X:93051421-93051443 CAAATATTTAGGCTAAATTGTGG + Intergenic
1194428533 X:93771016-93771038 CAAATATTTAGGCTAAATTCTGG + Intergenic
1196520796 X:116668389-116668411 CAAATATTTGGGTGAAATTCTGG - Intergenic
1196874208 X:120143210-120143232 CAAATATTTAGGCTAAATTGTGG - Intergenic
1197359322 X:125479480-125479502 CAAATATTTTGGCTACATAAAGG + Intergenic
1197360271 X:125493127-125493149 CAAATATTTAGGCTAAATTGTGG - Intergenic
1197468987 X:126843463-126843485 AGAATATTTAGGTGAAATTGAGG + Intergenic
1198286956 X:135200429-135200451 CACATATTTAGGGTTAACTGGGG + Intergenic
1199117670 X:144011645-144011667 AAAATATGTAGCCTAAATTAAGG - Intergenic
1199151736 X:144494909-144494931 CTTATATTTAGGCTAAATTGTGG + Intergenic
1199221933 X:145326617-145326639 CAAATATTTAGGCTAAATTGTGG + Intergenic
1199234478 X:145475083-145475105 CAAATATTTAGGCTAAATTGTGG + Intergenic
1199312161 X:146333041-146333063 CAAATATCTAGGCTAAATTCGGG + Intergenic
1200543531 Y:4490084-4490106 CAAATATTTAGGCTAAATTGTGG + Intergenic
1200677515 Y:6167646-6167668 CAAATATTTAGGCTAAATTGTGG + Intergenic
1200762466 Y:7052813-7052835 CAAATATTTAGGCTAAATTCTGG + Intronic
1201340007 Y:12924132-12924154 CAAATATTTGGGTGAAATTCTGG + Intergenic
1201641387 Y:16180881-16180903 CAAATATTTATGCTAAATTGTGG - Intergenic
1201661428 Y:16404441-16404463 CAAATATTTATGCTAAATTGTGG + Intergenic
1201668873 Y:16492709-16492731 CAAATATTTAGGATAAATTGTGG - Intergenic
1202073206 Y:21014032-21014054 CAAATACTTAGATTAAATTCTGG + Intergenic
1202077906 Y:21055886-21055908 CAAATACTTAGATTAAATTCTGG + Intergenic