ID: 1006412224

View in Genome Browser
Species Human (GRCh38)
Location 6:33880731-33880753
Sequence TTGTCCTGGGTTGCTTATAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006412220_1006412224 -3 Left 1006412220 6:33880711-33880733 CCACAATTTAGCCTAAATATTTG 0: 151
1: 94
2: 38
3: 32
4: 261
Right 1006412224 6:33880731-33880753 TTGTCCTGGGTTGCTTATACTGG No data
1006412219_1006412224 -2 Left 1006412219 6:33880710-33880732 CCCACAATTTAGCCTAAATATTT 0: 158
1: 96
2: 33
3: 40
4: 360
Right 1006412224 6:33880731-33880753 TTGTCCTGGGTTGCTTATACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006412224 Original CRISPR TTGTCCTGGGTTGCTTATAC TGG Intergenic
No off target data available for this crispr