ID: 1006415494

View in Genome Browser
Species Human (GRCh38)
Location 6:33901425-33901447
Sequence CCTGCCCTGAATGGTGTTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006415494_1006415499 28 Left 1006415494 6:33901425-33901447 CCTTTAACACCATTCAGGGCAGG No data
Right 1006415499 6:33901476-33901498 CAGTGTTCTTGAAATAAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006415494 Original CRISPR CCTGCCCTGAATGGTGTTAA AGG (reversed) Intergenic
No off target data available for this crispr