ID: 1006416256

View in Genome Browser
Species Human (GRCh38)
Location 6:33905847-33905869
Sequence TCCCTTAGCCTTCCCTGCGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006416249_1006416256 -9 Left 1006416249 6:33905833-33905855 CCCACCCCTGCCTTTCCCTTAGC No data
Right 1006416256 6:33905847-33905869 TCCCTTAGCCTTCCCTGCGGTGG No data
1006416248_1006416256 -5 Left 1006416248 6:33905829-33905851 CCTGCCCACCCCTGCCTTTCCCT No data
Right 1006416256 6:33905847-33905869 TCCCTTAGCCTTCCCTGCGGTGG No data
1006416250_1006416256 -10 Left 1006416250 6:33905834-33905856 CCACCCCTGCCTTTCCCTTAGCC No data
Right 1006416256 6:33905847-33905869 TCCCTTAGCCTTCCCTGCGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006416256 Original CRISPR TCCCTTAGCCTTCCCTGCGG TGG Intergenic
No off target data available for this crispr