ID: 1006416865

View in Genome Browser
Species Human (GRCh38)
Location 6:33909657-33909679
Sequence CTCATGTGGATGACACGCCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006416865_1006416872 22 Left 1006416865 6:33909657-33909679 CCTCGGCGTGTCATCCACATGAG No data
Right 1006416872 6:33909702-33909724 AGAAGGACATTTCATCCCGAGGG No data
1006416865_1006416876 30 Left 1006416865 6:33909657-33909679 CCTCGGCGTGTCATCCACATGAG No data
Right 1006416876 6:33909710-33909732 ATTTCATCCCGAGGGTGGGTGGG No data
1006416865_1006416873 25 Left 1006416865 6:33909657-33909679 CCTCGGCGTGTCATCCACATGAG No data
Right 1006416873 6:33909705-33909727 AGGACATTTCATCCCGAGGGTGG No data
1006416865_1006416869 5 Left 1006416865 6:33909657-33909679 CCTCGGCGTGTCATCCACATGAG No data
Right 1006416869 6:33909685-33909707 TGGCAGTCGGAGCCAAGAGAAGG No data
1006416865_1006416875 29 Left 1006416865 6:33909657-33909679 CCTCGGCGTGTCATCCACATGAG No data
Right 1006416875 6:33909709-33909731 CATTTCATCCCGAGGGTGGGTGG No data
1006416865_1006416871 21 Left 1006416865 6:33909657-33909679 CCTCGGCGTGTCATCCACATGAG No data
Right 1006416871 6:33909701-33909723 GAGAAGGACATTTCATCCCGAGG No data
1006416865_1006416868 -8 Left 1006416865 6:33909657-33909679 CCTCGGCGTGTCATCCACATGAG No data
Right 1006416868 6:33909672-33909694 CACATGAGAGAGTTGGCAGTCGG No data
1006416865_1006416874 26 Left 1006416865 6:33909657-33909679 CCTCGGCGTGTCATCCACATGAG No data
Right 1006416874 6:33909706-33909728 GGACATTTCATCCCGAGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006416865 Original CRISPR CTCATGTGGATGACACGCCG AGG (reversed) Intergenic
No off target data available for this crispr