ID: 1006416867

View in Genome Browser
Species Human (GRCh38)
Location 6:33909671-33909693
Sequence CGACTGCCAACTCTCTCATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006416867_1006416872 8 Left 1006416867 6:33909671-33909693 CCACATGAGAGAGTTGGCAGTCG No data
Right 1006416872 6:33909702-33909724 AGAAGGACATTTCATCCCGAGGG No data
1006416867_1006416874 12 Left 1006416867 6:33909671-33909693 CCACATGAGAGAGTTGGCAGTCG No data
Right 1006416874 6:33909706-33909728 GGACATTTCATCCCGAGGGTGGG No data
1006416867_1006416876 16 Left 1006416867 6:33909671-33909693 CCACATGAGAGAGTTGGCAGTCG No data
Right 1006416876 6:33909710-33909732 ATTTCATCCCGAGGGTGGGTGGG No data
1006416867_1006416875 15 Left 1006416867 6:33909671-33909693 CCACATGAGAGAGTTGGCAGTCG No data
Right 1006416875 6:33909709-33909731 CATTTCATCCCGAGGGTGGGTGG No data
1006416867_1006416869 -9 Left 1006416867 6:33909671-33909693 CCACATGAGAGAGTTGGCAGTCG No data
Right 1006416869 6:33909685-33909707 TGGCAGTCGGAGCCAAGAGAAGG No data
1006416867_1006416877 21 Left 1006416867 6:33909671-33909693 CCACATGAGAGAGTTGGCAGTCG No data
Right 1006416877 6:33909715-33909737 ATCCCGAGGGTGGGTGGGAGTGG No data
1006416867_1006416871 7 Left 1006416867 6:33909671-33909693 CCACATGAGAGAGTTGGCAGTCG No data
Right 1006416871 6:33909701-33909723 GAGAAGGACATTTCATCCCGAGG No data
1006416867_1006416873 11 Left 1006416867 6:33909671-33909693 CCACATGAGAGAGTTGGCAGTCG No data
Right 1006416873 6:33909705-33909727 AGGACATTTCATCCCGAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006416867 Original CRISPR CGACTGCCAACTCTCTCATG TGG (reversed) Intergenic
No off target data available for this crispr