ID: 1006416875

View in Genome Browser
Species Human (GRCh38)
Location 6:33909709-33909731
Sequence CATTTCATCCCGAGGGTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006416867_1006416875 15 Left 1006416867 6:33909671-33909693 CCACATGAGAGAGTTGGCAGTCG No data
Right 1006416875 6:33909709-33909731 CATTTCATCCCGAGGGTGGGTGG No data
1006416865_1006416875 29 Left 1006416865 6:33909657-33909679 CCTCGGCGTGTCATCCACATGAG No data
Right 1006416875 6:33909709-33909731 CATTTCATCCCGAGGGTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006416875 Original CRISPR CATTTCATCCCGAGGGTGGG TGG Intergenic
No off target data available for this crispr