ID: 1006416875 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 6:33909709-33909731 |
| Sequence | CATTTCATCCCGAGGGTGGG TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1006416867_1006416875 | 15 | Left | 1006416867 | 6:33909671-33909693 | CCACATGAGAGAGTTGGCAGTCG | No data | ||
| Right | 1006416875 | 6:33909709-33909731 | CATTTCATCCCGAGGGTGGGTGG | No data | ||||
| 1006416865_1006416875 | 29 | Left | 1006416865 | 6:33909657-33909679 | CCTCGGCGTGTCATCCACATGAG | No data | ||
| Right | 1006416875 | 6:33909709-33909731 | CATTTCATCCCGAGGGTGGGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1006416875 | Original CRISPR | CATTTCATCCCGAGGGTGGG TGG | Intergenic | ||
| No off target data available for this crispr | |||||