ID: 1006418564

View in Genome Browser
Species Human (GRCh38)
Location 6:33919525-33919547
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006418564_1006418568 -7 Left 1006418564 6:33919525-33919547 CCAGCCTAGAGGGGGCAACAGGC No data
Right 1006418568 6:33919541-33919563 AACAGGCAGAGGGAGCTTCCAGG No data
1006418564_1006418573 28 Left 1006418564 6:33919525-33919547 CCAGCCTAGAGGGGGCAACAGGC No data
Right 1006418573 6:33919576-33919598 CTAAACTAAGACCTCAAGGGTGG No data
1006418564_1006418569 -4 Left 1006418564 6:33919525-33919547 CCAGCCTAGAGGGGGCAACAGGC No data
Right 1006418569 6:33919544-33919566 AGGCAGAGGGAGCTTCCAGGAGG No data
1006418564_1006418572 25 Left 1006418564 6:33919525-33919547 CCAGCCTAGAGGGGGCAACAGGC No data
Right 1006418572 6:33919573-33919595 TGTCTAAACTAAGACCTCAAGGG No data
1006418564_1006418571 24 Left 1006418564 6:33919525-33919547 CCAGCCTAGAGGGGGCAACAGGC No data
Right 1006418571 6:33919572-33919594 ATGTCTAAACTAAGACCTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006418564 Original CRISPR GCCTGTTGCCCCCTCTAGGC TGG (reversed) Intergenic