ID: 1006418565

View in Genome Browser
Species Human (GRCh38)
Location 6:33919529-33919551
Sequence CTCTGCCTGTTGCCCCCTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006418565_1006418574 29 Left 1006418565 6:33919529-33919551 CCTAGAGGGGGCAACAGGCAGAG No data
Right 1006418574 6:33919581-33919603 CTAAGACCTCAAGGGTGGACAGG No data
1006418565_1006418572 21 Left 1006418565 6:33919529-33919551 CCTAGAGGGGGCAACAGGCAGAG No data
Right 1006418572 6:33919573-33919595 TGTCTAAACTAAGACCTCAAGGG No data
1006418565_1006418571 20 Left 1006418565 6:33919529-33919551 CCTAGAGGGGGCAACAGGCAGAG No data
Right 1006418571 6:33919572-33919594 ATGTCTAAACTAAGACCTCAAGG No data
1006418565_1006418569 -8 Left 1006418565 6:33919529-33919551 CCTAGAGGGGGCAACAGGCAGAG No data
Right 1006418569 6:33919544-33919566 AGGCAGAGGGAGCTTCCAGGAGG No data
1006418565_1006418573 24 Left 1006418565 6:33919529-33919551 CCTAGAGGGGGCAACAGGCAGAG No data
Right 1006418573 6:33919576-33919598 CTAAACTAAGACCTCAAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006418565 Original CRISPR CTCTGCCTGTTGCCCCCTCT AGG (reversed) Intergenic