ID: 1006418568

View in Genome Browser
Species Human (GRCh38)
Location 6:33919541-33919563
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006418564_1006418568 -7 Left 1006418564 6:33919525-33919547 CCAGCCTAGAGGGGGCAACAGGC No data
Right 1006418568 6:33919541-33919563 AACAGGCAGAGGGAGCTTCCAGG No data
1006418562_1006418568 -6 Left 1006418562 6:33919524-33919546 CCCAGCCTAGAGGGGGCAACAGG No data
Right 1006418568 6:33919541-33919563 AACAGGCAGAGGGAGCTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006418568 Original CRISPR AACAGGCAGAGGGAGCTTCC AGG Intergenic
No off target data available for this crispr