ID: 1006418569

View in Genome Browser
Species Human (GRCh38)
Location 6:33919544-33919566
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006418565_1006418569 -8 Left 1006418565 6:33919529-33919551 CCTAGAGGGGGCAACAGGCAGAG No data
Right 1006418569 6:33919544-33919566 AGGCAGAGGGAGCTTCCAGGAGG No data
1006418564_1006418569 -4 Left 1006418564 6:33919525-33919547 CCAGCCTAGAGGGGGCAACAGGC No data
Right 1006418569 6:33919544-33919566 AGGCAGAGGGAGCTTCCAGGAGG No data
1006418562_1006418569 -3 Left 1006418562 6:33919524-33919546 CCCAGCCTAGAGGGGGCAACAGG No data
Right 1006418569 6:33919544-33919566 AGGCAGAGGGAGCTTCCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006418569 Original CRISPR AGGCAGAGGGAGCTTCCAGG AGG Intergenic