ID: 1006418570

View in Genome Browser
Species Human (GRCh38)
Location 6:33919559-33919581
Sequence GTTTAGACATCTCTACCTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006418570_1006418576 17 Left 1006418570 6:33919559-33919581 CCAGGAGGTAGAGATGTCTAAAC No data
Right 1006418576 6:33919599-33919621 ACAGGAGCAAGCCAAGTGAAAGG No data
1006418570_1006418579 27 Left 1006418570 6:33919559-33919581 CCAGGAGGTAGAGATGTCTAAAC No data
Right 1006418579 6:33919609-33919631 GCCAAGTGAAAGGATCTGGGAGG No data
1006418570_1006418577 23 Left 1006418570 6:33919559-33919581 CCAGGAGGTAGAGATGTCTAAAC No data
Right 1006418577 6:33919605-33919627 GCAAGCCAAGTGAAAGGATCTGG No data
1006418570_1006418573 -6 Left 1006418570 6:33919559-33919581 CCAGGAGGTAGAGATGTCTAAAC No data
Right 1006418573 6:33919576-33919598 CTAAACTAAGACCTCAAGGGTGG No data
1006418570_1006418574 -1 Left 1006418570 6:33919559-33919581 CCAGGAGGTAGAGATGTCTAAAC No data
Right 1006418574 6:33919581-33919603 CTAAGACCTCAAGGGTGGACAGG No data
1006418570_1006418572 -9 Left 1006418570 6:33919559-33919581 CCAGGAGGTAGAGATGTCTAAAC No data
Right 1006418572 6:33919573-33919595 TGTCTAAACTAAGACCTCAAGGG No data
1006418570_1006418581 28 Left 1006418570 6:33919559-33919581 CCAGGAGGTAGAGATGTCTAAAC No data
Right 1006418581 6:33919610-33919632 CCAAGTGAAAGGATCTGGGAGGG No data
1006418570_1006418578 24 Left 1006418570 6:33919559-33919581 CCAGGAGGTAGAGATGTCTAAAC No data
Right 1006418578 6:33919606-33919628 CAAGCCAAGTGAAAGGATCTGGG No data
1006418570_1006418571 -10 Left 1006418570 6:33919559-33919581 CCAGGAGGTAGAGATGTCTAAAC No data
Right 1006418571 6:33919572-33919594 ATGTCTAAACTAAGACCTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006418570 Original CRISPR GTTTAGACATCTCTACCTCC TGG (reversed) Intergenic