ID: 1006418572

View in Genome Browser
Species Human (GRCh38)
Location 6:33919573-33919595
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006418565_1006418572 21 Left 1006418565 6:33919529-33919551 CCTAGAGGGGGCAACAGGCAGAG No data
Right 1006418572 6:33919573-33919595 TGTCTAAACTAAGACCTCAAGGG No data
1006418564_1006418572 25 Left 1006418564 6:33919525-33919547 CCAGCCTAGAGGGGGCAACAGGC No data
Right 1006418572 6:33919573-33919595 TGTCTAAACTAAGACCTCAAGGG No data
1006418562_1006418572 26 Left 1006418562 6:33919524-33919546 CCCAGCCTAGAGGGGGCAACAGG No data
Right 1006418572 6:33919573-33919595 TGTCTAAACTAAGACCTCAAGGG No data
1006418570_1006418572 -9 Left 1006418570 6:33919559-33919581 CCAGGAGGTAGAGATGTCTAAAC No data
Right 1006418572 6:33919573-33919595 TGTCTAAACTAAGACCTCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006418572 Original CRISPR TGTCTAAACTAAGACCTCAA GGG Intergenic