ID: 1006418745

View in Genome Browser
Species Human (GRCh38)
Location 6:33920454-33920476
Sequence CATTGTGAGCAGACTCTGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006418739_1006418745 -5 Left 1006418739 6:33920436-33920458 CCCAGCCCATCCTGGCTTCATTG No data
Right 1006418745 6:33920454-33920476 CATTGTGAGCAGACTCTGGTTGG No data
1006418736_1006418745 6 Left 1006418736 6:33920425-33920447 CCTTCCTGACTCCCAGCCCATCC No data
Right 1006418745 6:33920454-33920476 CATTGTGAGCAGACTCTGGTTGG No data
1006418741_1006418745 -10 Left 1006418741 6:33920441-33920463 CCCATCCTGGCTTCATTGTGAGC No data
Right 1006418745 6:33920454-33920476 CATTGTGAGCAGACTCTGGTTGG No data
1006418731_1006418745 21 Left 1006418731 6:33920410-33920432 CCTTGACCCCCTGCACCTTCCTG No data
Right 1006418745 6:33920454-33920476 CATTGTGAGCAGACTCTGGTTGG No data
1006418738_1006418745 2 Left 1006418738 6:33920429-33920451 CCTGACTCCCAGCCCATCCTGGC No data
Right 1006418745 6:33920454-33920476 CATTGTGAGCAGACTCTGGTTGG No data
1006418733_1006418745 14 Left 1006418733 6:33920417-33920439 CCCCTGCACCTTCCTGACTCCCA No data
Right 1006418745 6:33920454-33920476 CATTGTGAGCAGACTCTGGTTGG No data
1006418735_1006418745 12 Left 1006418735 6:33920419-33920441 CCTGCACCTTCCTGACTCCCAGC No data
Right 1006418745 6:33920454-33920476 CATTGTGAGCAGACTCTGGTTGG No data
1006418732_1006418745 15 Left 1006418732 6:33920416-33920438 CCCCCTGCACCTTCCTGACTCCC No data
Right 1006418745 6:33920454-33920476 CATTGTGAGCAGACTCTGGTTGG No data
1006418729_1006418745 28 Left 1006418729 6:33920403-33920425 CCCATCTCCTTGACCCCCTGCAC No data
Right 1006418745 6:33920454-33920476 CATTGTGAGCAGACTCTGGTTGG No data
1006418730_1006418745 27 Left 1006418730 6:33920404-33920426 CCATCTCCTTGACCCCCTGCACC No data
Right 1006418745 6:33920454-33920476 CATTGTGAGCAGACTCTGGTTGG No data
1006418740_1006418745 -6 Left 1006418740 6:33920437-33920459 CCAGCCCATCCTGGCTTCATTGT No data
Right 1006418745 6:33920454-33920476 CATTGTGAGCAGACTCTGGTTGG No data
1006418734_1006418745 13 Left 1006418734 6:33920418-33920440 CCCTGCACCTTCCTGACTCCCAG No data
Right 1006418745 6:33920454-33920476 CATTGTGAGCAGACTCTGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006418745 Original CRISPR CATTGTGAGCAGACTCTGGT TGG Intergenic
No off target data available for this crispr