ID: 1006419178

View in Genome Browser
Species Human (GRCh38)
Location 6:33922903-33922925
Sequence TTCCCCAGTGGCTGTCCCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006419178_1006419181 8 Left 1006419178 6:33922903-33922925 CCATGGGGACAGCCACTGGGGAA No data
Right 1006419181 6:33922934-33922956 CCCAGAGACACAACCCCCACTGG No data
1006419178_1006419183 9 Left 1006419178 6:33922903-33922925 CCATGGGGACAGCCACTGGGGAA No data
Right 1006419183 6:33922935-33922957 CCAGAGACACAACCCCCACTGGG No data
1006419178_1006419188 22 Left 1006419178 6:33922903-33922925 CCATGGGGACAGCCACTGGGGAA No data
Right 1006419188 6:33922948-33922970 CCCCACTGGGCCCGGAGTGGAGG No data
1006419178_1006419184 14 Left 1006419178 6:33922903-33922925 CCATGGGGACAGCCACTGGGGAA No data
Right 1006419184 6:33922940-33922962 GACACAACCCCCACTGGGCCCGG No data
1006419178_1006419185 19 Left 1006419178 6:33922903-33922925 CCATGGGGACAGCCACTGGGGAA No data
Right 1006419185 6:33922945-33922967 AACCCCCACTGGGCCCGGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006419178 Original CRISPR TTCCCCAGTGGCTGTCCCCA TGG (reversed) Intergenic
No off target data available for this crispr