ID: 1006419184

View in Genome Browser
Species Human (GRCh38)
Location 6:33922940-33922962
Sequence GACACAACCCCCACTGGGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006419178_1006419184 14 Left 1006419178 6:33922903-33922925 CCATGGGGACAGCCACTGGGGAA No data
Right 1006419184 6:33922940-33922962 GACACAACCCCCACTGGGCCCGG No data
1006419177_1006419184 15 Left 1006419177 6:33922902-33922924 CCCATGGGGACAGCCACTGGGGA No data
Right 1006419184 6:33922940-33922962 GACACAACCCCCACTGGGCCCGG No data
1006419179_1006419184 2 Left 1006419179 6:33922915-33922937 CCACTGGGGAAGCTCTCTGCCCA No data
Right 1006419184 6:33922940-33922962 GACACAACCCCCACTGGGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006419184 Original CRISPR GACACAACCCCCACTGGGCC CGG Intergenic
No off target data available for this crispr