ID: 1006421184

View in Genome Browser
Species Human (GRCh38)
Location 6:33935188-33935210
Sequence CCTTCTATGGAGGCCATGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006421184_1006421191 3 Left 1006421184 6:33935188-33935210 CCCACCATGGCCTCCATAGAAGG No data
Right 1006421191 6:33935214-33935236 GTGGACATTGTCTGCCTTTTTGG No data
1006421184_1006421194 20 Left 1006421184 6:33935188-33935210 CCCACCATGGCCTCCATAGAAGG No data
Right 1006421194 6:33935231-33935253 TTTTGGAACTTGGATCTGAGTGG No data
1006421184_1006421196 27 Left 1006421184 6:33935188-33935210 CCCACCATGGCCTCCATAGAAGG No data
Right 1006421196 6:33935238-33935260 ACTTGGATCTGAGTGGACCTGGG No data
1006421184_1006421195 26 Left 1006421184 6:33935188-33935210 CCCACCATGGCCTCCATAGAAGG No data
Right 1006421195 6:33935237-33935259 AACTTGGATCTGAGTGGACCTGG No data
1006421184_1006421192 10 Left 1006421184 6:33935188-33935210 CCCACCATGGCCTCCATAGAAGG No data
Right 1006421192 6:33935221-33935243 TTGTCTGCCTTTTTGGAACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006421184 Original CRISPR CCTTCTATGGAGGCCATGGT GGG (reversed) Intergenic
No off target data available for this crispr