ID: 1006421545

View in Genome Browser
Species Human (GRCh38)
Location 6:33937208-33937230
Sequence CATATTAGGCAGTAAGTAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006421545_1006421548 13 Left 1006421545 6:33937208-33937230 CCTGTTACTTACTGCCTAATATG No data
Right 1006421548 6:33937244-33937266 AGATTCAACCATAAGCAGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006421545 Original CRISPR CATATTAGGCAGTAAGTAAC AGG (reversed) Intergenic
No off target data available for this crispr