ID: 1006421546

View in Genome Browser
Species Human (GRCh38)
Location 6:33937222-33937244
Sequence TCATCAGCTAGGAACATATT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006421546_1006421548 -1 Left 1006421546 6:33937222-33937244 CCTAATATGTTCCTAGCTGATGA No data
Right 1006421548 6:33937244-33937266 AGATTCAACCATAAGCAGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006421546 Original CRISPR TCATCAGCTAGGAACATATT AGG (reversed) Intergenic