ID: 1006421682

View in Genome Browser
Species Human (GRCh38)
Location 6:33938426-33938448
Sequence GAAAATGGACTAATCCAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006421682_1006421685 3 Left 1006421682 6:33938426-33938448 CCCAGCTGGATTAGTCCATTTTC No data
Right 1006421685 6:33938452-33938474 TTGCTATAAAGAATTACCTGAGG No data
1006421682_1006421688 28 Left 1006421682 6:33938426-33938448 CCCAGCTGGATTAGTCCATTTTC No data
Right 1006421688 6:33938477-33938499 CGGTAATTTATAAAGAAAAGAGG 0: 36
1: 4352
2: 10301
3: 9125
4: 5380
1006421682_1006421686 8 Left 1006421682 6:33938426-33938448 CCCAGCTGGATTAGTCCATTTTC No data
Right 1006421686 6:33938457-33938479 ATAAAGAATTACCTGAGGCTCGG 0: 4
1: 377
2: 3787
3: 9820
4: 12187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006421682 Original CRISPR GAAAATGGACTAATCCAGCT GGG (reversed) Intergenic
No off target data available for this crispr