ID: 1006424931

View in Genome Browser
Species Human (GRCh38)
Location 6:33958081-33958103
Sequence CTGTGGCTATGGCACTCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006424931_1006424944 29 Left 1006424931 6:33958081-33958103 CCTCCTGAGTGCCATAGCCACAG No data
Right 1006424944 6:33958133-33958155 CCCGCGCCTAGGATGGTGAGAGG No data
1006424931_1006424937 4 Left 1006424931 6:33958081-33958103 CCTCCTGAGTGCCATAGCCACAG No data
Right 1006424937 6:33958108-33958130 CAACCAGGAATGAAAGCCGGAGG No data
1006424931_1006424941 22 Left 1006424931 6:33958081-33958103 CCTCCTGAGTGCCATAGCCACAG No data
Right 1006424941 6:33958126-33958148 GGAGGACCCCGCGCCTAGGATGG No data
1006424931_1006424939 18 Left 1006424931 6:33958081-33958103 CCTCCTGAGTGCCATAGCCACAG No data
Right 1006424939 6:33958122-33958144 AGCCGGAGGACCCCGCGCCTAGG No data
1006424931_1006424936 1 Left 1006424931 6:33958081-33958103 CCTCCTGAGTGCCATAGCCACAG No data
Right 1006424936 6:33958105-33958127 ACACAACCAGGAATGAAAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006424931 Original CRISPR CTGTGGCTATGGCACTCAGG AGG (reversed) Intergenic
No off target data available for this crispr