ID: 1006426746

View in Genome Browser
Species Human (GRCh38)
Location 6:33968124-33968146
Sequence GCTGCAATGGGGAATGCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006426746_1006426760 28 Left 1006426746 6:33968124-33968146 CCTCCTGCATTCCCCATTGCAGC No data
Right 1006426760 6:33968175-33968197 CGCAAGTCACACACCACCATGGG No data
1006426746_1006426755 5 Left 1006426746 6:33968124-33968146 CCTCCTGCATTCCCCATTGCAGC No data
Right 1006426755 6:33968152-33968174 TACCAGTCTCCATCCAAAGAGGG No data
1006426746_1006426754 4 Left 1006426746 6:33968124-33968146 CCTCCTGCATTCCCCATTGCAGC No data
Right 1006426754 6:33968151-33968173 GTACCAGTCTCCATCCAAAGAGG No data
1006426746_1006426759 27 Left 1006426746 6:33968124-33968146 CCTCCTGCATTCCCCATTGCAGC No data
Right 1006426759 6:33968174-33968196 GCGCAAGTCACACACCACCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006426746 Original CRISPR GCTGCAATGGGGAATGCAGG AGG (reversed) Intergenic
No off target data available for this crispr