ID: 1006428326

View in Genome Browser
Species Human (GRCh38)
Location 6:33979988-33980010
Sequence GGAATGAATTATATGAGATA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006428324_1006428326 2 Left 1006428324 6:33979963-33979985 CCAGGGTTGATCAAGGGTAGGGA No data
Right 1006428326 6:33979988-33980010 GGAATGAATTATATGAGATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006428326 Original CRISPR GGAATGAATTATATGAGATA AGG Intergenic