ID: 1006428327 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 6:33979992-33980014 |
| Sequence | TGAATTATATGAGATAAGGT TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1006428324_1006428327 | 6 | Left | 1006428324 | 6:33979963-33979985 | CCAGGGTTGATCAAGGGTAGGGA | No data | ||
| Right | 1006428327 | 6:33979992-33980014 | TGAATTATATGAGATAAGGTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1006428327 | Original CRISPR | TGAATTATATGAGATAAGGT TGG | Intergenic | ||