ID: 1006428328

View in Genome Browser
Species Human (GRCh38)
Location 6:33980014-33980036
Sequence GTGTTTTGACCCCCAAACTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006428324_1006428328 28 Left 1006428324 6:33979963-33979985 CCAGGGTTGATCAAGGGTAGGGA No data
Right 1006428328 6:33980014-33980036 GTGTTTTGACCCCCAAACTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006428328 Original CRISPR GTGTTTTGACCCCCAAACTT TGG Intergenic